IMR Press / FBL / Volume 29 / Issue 5 / DOI: 10.31083/j.fbl2905180
Open Access Original Research
Newly Isolated Limosilactobacillus reuteri B1/1 Modulates the Expression of Cytokines and Antimicrobial Proteins in a Porcine ex Vivo Model
Show Less
1 Department of Morphological Disciplines, University of Veterinary Medicine and Pharmacy in Košice, 040 01 Košice, Slovakia
2 Center of Clinical and Preclinical Research MediPark, Faculty of Medicine, P.J. Šafárik University in Košice, 040 01 Košice, Slovakia
3 Department of Microbiology and Immunology, University of Veterinary Medicine and Pharmacy in Košice, 040 01 Košice, Slovakia
*Correspondence: viera.karaffova@uvlf.sk (Viera Karaffová)
Front. Biosci. (Landmark Ed) 2024, 29(5), 180; https://doi.org/10.31083/j.fbl2905180
Submitted: 25 January 2024 | Revised: 21 March 2024 | Accepted: 8 April 2024 | Published: 10 May 2024
Copyright: © 2024 The Author(s). Published by IMR Press.
This is an open access article under the CC BY 4.0 license.
Abstract

Background: The epithelia of the intestine perform various functions, playing a crucial role in providing a physical barrier and an innate immune defense against infections. By generating a “three-dimensional” (3D) model of cell co-cultures using the IPEC-J2 cell line and porcine blood monocyte-derived macrophages (MDMs), we are getting closer to mimicking the porcine intestine ex vivo.Methods: The effect of Limosilactobacillus reuteri B1/1 and Limosilactobacillus fermentum CCM 7158 (indicator strain) on the relative gene expression of interleukins (IL-1β, IL-6, IL-8, IL-18 and IL-10), genes encoding receptors for TLR4 and TLR2, tight junction proteins such as claudin-1 (CLDN1), occludin (OCLN) and important antimicrobial proteins such as lumican (LUM) and olfactomedin-4 (OLMF-4) was monitored in this model. Results: The results obtained from this pilot study point to the immunomodulatory potential of newly isolated L. reuteri B1/1, as it was able to suppress the enhanced pro-inflammatory response to lipopolysaccharide (LPS) challenge in both cell types. L. reuteri B1/1 was even able to up-regulate the mRNA levels of genes encoding antimicrobial proteins LUM and OLFM-4 and to increase tight junction (TJ)-related genes CLDN1 and OCLN, which were significantly down-regulated in LPS-induced IPEC-J2 cells. Conversely, L. fermentum CCM 7158, chosen as an indicator lactic acid bacteria (LAB) strain, increased the mRNA levels of the investigated pro-inflammatory cytokines (IL-18, IL-6, and IL-1β) in MDMs when LPS was simultaneously applied to basally deposited macrophages. Although L. fermentum CCM 7158 induced the production of pro-inflammatory cytokines, synchronous up-regulation of the anti-inflammatory cytokine IL-10 was detected in both LAB strains used in both cell cultures. Conclusions: The obtained results suggest that the recently isolated LAB strain L. reuteri B1/1 has the potential to alleviate epithelial disruption caused by LPS and to influence the production of antimicrobial molecules by enterocytes.

Keywords
co-culture
IPEC-J2
MDM
lactobacilli
tight-junctions
cytokines
1. Introduction

The increased productivity in livestock husbandry accompanied by heightened demands on the quality of the meat produced. At the same time, the livestock industry represents an important economic activity in many countries. In large-scale farms, intensive conditions expose animals to stress, resulting in diseases and environmental decline, leading to significant economic losses. Treatment of these diseases has led to a surge in the use of veterinary drugs, fostering antimicrobial resistance and posing risks to consumers [1]. Health is closely tied to mucosal immunity and the intestinal microbiome. The intricate interactions between the host and the gut microbiome impact nutrient exchange, thereby influencing gut physiology, immunity, and morphology. On the other hand, the presence of intestinal pathogens can lead to undesirable changes in the morphology of the intestine [2]. Therefore, it is essential to promote sufficient cooperation and activation of the mucosal immune system, particularly through the production of antimicrobial proteins. Protein molecules such as lumican and olfactomedin-4 may promote intestinal homeostasis by initiating innate immune inflammatory responses that are beneficial in the early stages of enteritis and colitis [3, 4]. The mucosal surface of the intestine is formed by an epithelium, while tight junctions (TJs) exist between the epithelial cells, forming a continuous intercellular barrier, which is necessary for the separation of tissue spaces and the regulation of the selective movement of dissolved substances [5]. Both the occludin and claudin families represent TJ transmembrane proteins capable of adhesive interactions with other molecules between adhered cells, including the control of ion selectivity [6].

Consequently, there is a high demand for natural substances that have a beneficial effect on animal health, including protection against infectious diseases. Probiotic bacteria are undoubtedly among the most widely used substances of natural origin [7]. The effect of probiotics can vary depending on the properties of the specific probiotic bacteria used as well as their combination. Limosilactobacillus reuteri (L. reuteri) is among the most studied probiotic strains, which dominantly colonizes the intestines of mammals and humans. It is considered an “intestinal probiotic with prebiotic efficacy” because most of them show remarkable intestinal colonization including the secretion of bacteriocins, which also increases the expression of mucin genes, thus supporting the development and maturation of intestinal organoids and increasing the secretion of mucin itself [8]. Both animal and human studies suggest that probiotics can significantly influence the modulation of immune and inflammatory mechanisms. The use of probiotics can improve the balance of intestinal microorganisms, increase mucus secretion, and reduce the degradation of TJ proteins by reducing the presence of bacterial lipopolysaccharide (LPS) [9, 10]. Probiotic microorganisms, together with intestinal symbionts, also modulate host intestinal barrier function through their metabolites and various surface molecules [11]. In addition to this, they also promote host health by strengthening the intestinal barrier through various direct and indirect mechanisms [12]. Studying the mechanism of action for each probiotic strain is crucial. Typically, potential strains undergo microbiological testing in vitro and on two-dimensional (2D) cell lines. However, these lines lack realism in mimicking the natural reactions of the organism. Utilizing 3D animal gut models is proving to be more suitable, offering a closer simulation of the in vivo intestinal environment and facilitating a detailed study of bacteria-gut interactions. It’s important to note that live animal experiments are subject to legal restrictions in the European Union due to ethical concerns [13].

In a previous study, we demonstrated that L. reuteri B1/1 exhibited substantial adherence to non-carcinogenic porcine-derived enterocytes (CLAB) cells, especially at a concentration of 1 × 109 CFU. This lactic acid bacteria (LAB) strain not only influenced the gene expression of pro-inflammatory cytokines and the gene expression for lumican and olfactomedin-4, but also heightened the metabolic activity of the cells after a 4 h incubation period. As the newly isolated L. reuteri B1/1 was to be included in the microorganism collection, we decided to test it further on a Transwell insert model that more closely mimics the gut. Therefore, the aim of the present study was to monitor the effect of L. reuteri B1/1 and L. fermentum CCM 7158, chosen as an indicator LAB strain, on relative gene expression of interleukins (IL-1β, IL-6, IL-8, IL-18 and IL-10), genes encoding receptors for TLR4 and TLR2, TJ proteins such as claudin-1 (CLDN1), occludin (OCLN) and important antimicrobial proteins such as lumican (LUM) and olfactomedin-4 (OLMF-4) produced by the IPEC-J2 cell line and monocyte-derived macrophages (MDMs) in a co-culture model.

2. Materials and Methods
2.1 IPEC-J2 Cell Culture

The intestinal porcine epithelial cell line IPEC-J2 was obtained from J.J. Garrido from the University of Córdoba, Spain and was authenticated using Short Tandem Repeat (STR) profiling. Epithelial cells were maintained exactly as previously described in the study by Kiššová et al. [14]. After reaching a 75 % monolayer confluence on culture flasks, the cells were released and transferred to a new culture flask, as follows: cells were incubated with EDTA (1 mmol/L; Sigma-Aldrich, St. Louis, MA, USA) for 5 min at 37 °C with 5 % CO2, then the EDTA solution was replaced with 1× concentrated trypsin (Sigma-Aldrich) for 10 min at 37 °C with 5 % CO2 to release adhered cells from the flasks. The effect of trypsin was neutralized by adding 20 % FBS from the total cell volume and the suspension was centrifuged at 300 ×g for 5 min. IPEC-J2 cells were used from the 25th to 35th passages, and regularly checked for mycoplasma contamination using PCR analysis [15]. For co-culture experiments, the IPEC-J2 cells were treated according to the previously described protocol [16]. Briefly, the IPEC-J2 cells were seeded on the top of collagenase cell culture inserts (Transwell® system, 12 mm diameter, 1.12 cm2, 0.4 µm pore size; Costar, Corning BV, The Netherlands) at a density of 2.5 × 105 cells per cell culture insert and were cultivated under a humidified atmosphere (5 % CO2 at 37 °C) for 15 days.

2.2 Monocyte-Derived Macrophages (MDMs)

Blood samples were collected aseptically from the supraorbital sinus of healthy pigs aged 10 to 12 weeks. The pigs were of a Landrace crossbreed with The Large White, and were housed at the Clinic of Swine of the University of Veterinary Medicine and Pharmacy in Košice. The collection procedure adhered strictly to animal welfare guidelines and was approved by ethics committee namely “Ethics committee for the approval of research involving animals in accordance with the legislative requirements applicable at the UVMP in Košice” (Ethics committee at the UVMP in Košice, permit No. EKVP/2023-04). Blood samples were collected in 50 mL tubes filled with 1.5 % heparin prepared in phosphate-buffered saline (PBS). Mononuclear leukocytes (MNL) were obtained from the heparinized blood diluted 1:1 in PBS, underlayed with 15 mL separation solution (LSM1077 “Lymphocyte Separation Medium”; PAA, Austria) in Leucosep™ tubes (Greiner-Bio-One, Frickenhausen, Austria) and centrifuged (300 ×g for 20 min). MNLs were collected from the interface, then transferred to new 50 mL tubes and centrifuged (300 ×g for 20 min) then the obtained cell pellet was washed twice more in 20 mL of PBS 300 ×g for 20 min. After the final centrifugation, the supernatant was discarded and the MNL pellet was resuspended in 20 mL of RPMI 1640 (Roswell Park Memorial Institute-1640; Sigma-Aldrich) medium. Two milliliters of cell suspension was added into each of 12- well plates and monocytes were allowed to adhere during 2 h incubation at 37 °C in 5 % CO2, after which the non-adherent cells were removed by washing with PBS. The generation of MDMs was handled according to modified culture protocols [17, 18, 19]. Adherent monocytes were incubated in RPMI 1640 culture media supplemented with glutamine (2 mmol/L-1; Lonza, Switzerland), heat-inactivated FBS (10 %; Lonza, Switzerland), gentamicin (1 %; PAA, Cölbe, Germany) and cytokine M-CSF (50 ng/mL-1; R&D Systems, Minneapolis, MN, USA) at a temperature of 37 °C in an atmosphere enriched with 5 % CO2 for 5 days. The culture medium was changed every other day.

2.3 Bacterial Strains

Limosilactobacillus reuteri B1/1 and Limosilactobacillus fermentum CCM 7158 strains were grown in de Man Rogosa Sharpe (MRS) broth (Merck) at 37 °C overnight. The strains were then centrifuged at 500 ×g for 10 min, the pellets were washed three times in PBS and resuspended in antibiotic-free DMEM/F12 medium. The concentration of bacteria was adjusted to 107 CFU/mL according to the optical density measurement at 600 nm (EON Biotek, Winooski, VT, USA). Enterocytes IPEC-J2 were treated with 100 µL of bacterial suspension per insert membrane.

2.4 Experimental Design of the Co-Culture Model of Epithelial IPEC-J2 Cell Line and MDMs

Cells were grown on semipermeable membrane inserts as mentioned above, for 15 days to allow differentiation and establish tight epithelial monolayers. Fresh culture medium was changed every other day. On the day of the experiment, inserts containing monolayers of differentiated IPEC-J2 cells were transferred to 12-well plates with differentiated MDMs at the bottom of the well. Complete antibiotic-free DMEM/F-12 medium was added to the upper and lower chambers of the inserts. Only confluent monolayers of differentiated IPEC-J2 grown on a semipermeable membrane for 13–15 days with transepithelial electrical resistance (TEER) 1 kΩ/cm2 were used in the experiments. L. reuteri or L. fermentum was added to differentiated IPEC-J2, and simultaneously LPS was added to MDMs representing the basolateral compartment of the co-culture model (Fig. 1). The effect of Limosilactobacilli (1 × 106 CFU/ insert) and LPS (1 µg/mL E. coli serotype O55:B5; Sigma-Aldrich) on intestinal barrier markers (TEER, permeability) and changes in gene expression were evaluated after 24 h of treatment (Table 1).

Fig. 1.

Schematic illustration of a co-culture system of IPEC-J2/MDMs. IPEC-J2 cells representing the apical compartment were treated with either Limosilactobacillus reuteri B1/1 or Limosilactobacillus fermentum CCM 7158 (1 × 106 CFU/insert). MDMs representing the basolateral compartment were treated with LPS (1 µg/mL).

Table 1.Table of cell treatment during experiments.
Cell treatment Design of experiments in co-cultures Abbreviation
Control IPEC-J2 or MDMs without treatment -
LPS challenge MDMs were induced with LPS (1 µg/mL) and incubated for 24 h LPS
L. fermentum CCM7158/ LPS treatment IPEC-J2 were cells treated with probiotic LF (1 × 106 CFU/insert) and the MDMs were simultaneously induced with LPS (1 µg/mL) and incubated for 24 h LF + LPS
L. reuteri B1/1 + LPS treatment IPEC-J2 were cells treated with probiotic LR (1 × 106 CFU/insert) and the MDMs were simultaneously induced with LPS (1 µg/mL) and incubated for 24 h LR + LPS

MDMs, monocyte-derived macrophages; LPS, lipopolysaccharide.

2.5 Determination of TEER and Permeability

TEER was measured using an epithelial voltohmmeter EVOM2 (World Precision Instruments, Sarasota, FL, USA) connected to the STX4 electrode. The change in TEER was monitored after 3, 6, and 24 h, and individual TEER values were calculated by subtracting the value of the empty insert and multiplying it by the surface area of the membrane. TEER values at 3, 6, and 24 h were normalized to the own TEER value of the insert at 0 h. To assess the integrity of the formed IPEC-J2 cell monolayer on insert membranes, the monolayer permeability test was carried out using the fluorescent dye Lucifer Yellow (LY, Thermo Fisher Scientific, Waltham, MA, USA). Cell monolayers of differentiated epithelial cells were first washed with Hanks’ balanced salt solution (HBSS; Sigma-Aldrich), and then 500 µL of LY solution in HBSS (40 µg/mL) was added to the apical side and 1300 µL of HBSS to the basolateral side of well, followed by incubation on a shaker in the dark. After 1 h, the solution was collected from the basolateral side of the well and the fluorescence intensity was measured on a Synergy H4 hybrid plate reader (Bio-Tek Instruments, Winooski, VT, USA) using a 485 nm excitation and 530 nm emission filter. All measurements were performed in triplicate.

2.6 Gene Expression Analysis
2.6.1 RNA Isolation from the Cells and a Complementary cDNA Synthesis

High-quality total RNA was isolated using the TRI reagent (Sigma-Aldrich) and then purified using RNeasy mini kit (Qiagen, Manchester, UK) exactly according to the manufacturer’s instructions. RNA purity and concentration were determined using spectrophotometer NanoPhotometer P-Class P 300 (Implen, Munich, Germany) at rations 260/280 nm 260/230 and then reversely transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. The resulting cDNA from the cells was stored at –18 °C until further use.

2.6.2 Real-Time Quantitative PCR Analysis (qPCR)

The qPCR analysis was performed on a Lightcycler 480 II Instrument (Roche Holding AG, Basel, Switzerland) using LightCycler® Software (LightCycler® Software 4.1, Basel, Switzerland) in a 10 µL reaction volume consisting of 1× SsoAdvanced™ Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.5 µmol/L forward and reverse primers and 40 µg/µL cDNA (from IPEC-J2 or MDMs). All of the forward and reverse primers used are listed in Table 2 (Ref. [20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30]). For internal control, hypoxanthine-guanine phosphoribosyltransferase (HPRT) was used as a reference gene for IPEC-J2 cells and β-actin was used as an internal control for MDMs. The experimental protocol of qPCR consisted of an initial denaturation at 95 °C for 30 s, followed by amplification in 37 cycles consisting of 3 main steps—denaturation at 95 °C for 15 s, hybridization at 60 °C for 30 s, and extension at 72 °C for 2 min—followed by melting curve analysis to confirm amplification of the specific product. Relative normalized expression levels were assessed using the 2-ΔΔCT method. Gene expression analysis was conducted in triplicate and results are presented as mean ± standard deviation (SD).

Table 2.Table of used primers.
Gene Primer Sequence 5 3 Reference
β-actin Forward CATCACCATCGGCAACGA [20]
Reverse GCGTAGAGGTCCTTCCTGATGT
HPRT Forward AACCTTGCTTTCCTTGGTCA [21]
Reverse TCAAGGGCATAGCCTACCAC
IL-18 Forward CTGCTGAACCGGAAGACAAT [20]
Reverse TCCGATTCCAGGTCTTCATC
IL-1β Forward GCCCTGTACCCCAACTGGTA [22]
Reverse CCAGGAAGACGGGCTTTTG
IL-6 Forward CCACCAGGAACGAAAGAGAG [23]
Reverse AGGCAGTAGCCATCACCAGA
IL-8 Forward TTATCGGAGGCCACAATAAG [24]
Reverse TGGAATAGTAGATGGAGCCA
IL-10 Forward TGTCATCAATTTCTGCCCTGT [25]
Reverse TCTTCATCGTCATGTAGGCTT
TLR2 Forward CCAGGCAAGTGGATTATTGA [26]
Reverse AAGAGACGGAAGTGGGAGAA
TLR4 Forward TGGTGTCCCAGCACTTCATA [27]
Reverse CGGCATGACTCCTCAGAAAC
CLDN1 Forward TGGTCAGGCTCTCTTCACTG [28]
Reverse TTGGATAGGGCCTTGGTGTT
OCLN Forward ATGCTTTCTCAGCCAGCGTA [29]
Reverse AAGGTTCCATAGCCTCGGTC
LUM Forward ACCTGCGTTTGTCTCATAAT [30]
Reverse ATTGTAGGAGAGATCCAGCT
OLFM-4 Forward GGTGATTTACGCAACTGAAG [30]
Reverse GTTTGTACTGCTTGGTATGC
2.7 Statistical Analysis

The results from the gene expression analysis are expressed as the mean and the SD of two independent experiments which were conducted in triplicate. GraphPad Prism 9.0.0 software (La Jolla, California, UK) was used to determine significant differences by one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparisons. The level of significance was set as *p 0.05 considered significant, **p 0.01 considered highly significant, and ***p 0.001 considered highly significant.

3. Results
3.1 TEER Values

During the course of the experiments, TEER values of the formed IPEC-J2 monolayers were measured after 3, 6, and 24 h in order to monitor the integrity of the cell barrier (Fig. 2). As shown in Fig. 2, the initial TEER values of the co-cultures did not differ from the control group of cells after 3 h of incubation. TEER values of differentiated IPEC-J2 cells decreased after 6 h (p 0.05) and 24 h (p 0.001) of co-incubation with LPS-stimulated MDMs compared to the control group. Twenty-four-hour treatment of IPEC-J2 cells with either L. reuteri or L. fermentum also statistically significantly reduced TEER values relative to control, but TEER values were still above 1 kΩ.cm2.

Fig. 2.

Assessment of transepithelial electrical resistance. (a) Transepithelial electrical resistance (TEER) values at 3, 6, and 24 h were normalized to the own TEER value of insert at 0 h. (b) The effect of both lactobacilli on the epithelial barrier enhanced integrity. TEER values measured after 6 h and 24 h of incubation. Results of individual TEER measurements are expressed as a percentage. The control groups represent 100 % (±18) of the individual measurements. The level of significance was set as *p 0.05 considered significant, **p 0.01 considered highly significant, and ***p 0.001 considered highly significant.

3.2 Assessment of Monolayer Permeability Test

Lucifer yellow represents a small molecule able to cross through the epithelial barrier by passive paracellular diffusion. Given its hydrophilic nature and small molecular size, LY can be employed to chemically assess the functionality of TJs [31]. LPS induced a significant increase in LY flux measured after 24 h. None of the lactobacilli were able to significantly attenuate the LPS-induced increase in permeability in agreement with the TEER results (Fig. 3).

Fig. 3.

Monolayer permeability test in IPEC-J2. Lucifer yellow was used for the macromolecular permeability test of the IPEC-J2 monolayer. The monolayer permeability test was performed in all experimental groups (a) and also in IPEC-J2 cells incubated with probiotic isolates only (b). After incubation with LY for 1 h, the solution was collected from the basolateral side of the well and the fluorescence intensity was measured. The results are expressed as a percentage. The level of significance was set as *p 0.05 considered significant.

3.3 Transcriptional Response of Pro-Inflammatory Related Genes in IPEC-J2 Cells and MDMs within the Co-Culture Model

The pathological effect of LPS from E.coli was evaluated in an in vivo-like co-culture model by challenging MDMs in the basolateral compartment. The effect of LPS was assessed by analyzing the gene expression of important pro-inflammatory cytokines (IL-1β, IL-6, IL-8, IL-18) not only in directly treated MDMs but also in directly untreated IPEC-J2 cells in the apical compartment. The results obtained from both cell cultures confirm the pathological effect of LPS at the concentration used (1 µg/mL), as the monitored pro-inflammatory cytokines were significantly up-regulated in both cell cultures (Figs. 4,5). Direct stimulation of MDMs resulted in an up-regulation of IL-8 gene expression (p 0.001) (Fig. 5), whereas in undirectly treated IPEC-J2 cells an increased gene expression of IL-8 (p 0.05), IL-1β and IL-6 (p 0.001) was observed (Fig. 4).

Fig. 4.

Gene expression in IPEC-J2 cells. Gene expression analysis of pro-inflammatory related genes, TJ-related genes, and Toll-like receptors in IPEC-J2 cells. The level of significance was set as *p 0.05 considered significant, **p 0.01 considered highly significant, and ***p 0.001 considered highly significant. a—Significantly differed from the control group (*p 0.05; **p 0.01; ***p 0.001). b—Significantly differed from the LPS group (*p 0.05; **p 0.01; ***p 0.001).

Fig. 5.

Gene expression in MDMs. Gene expression analysis of pro-inflammatory related genes, TJ-related genes, and Toll-like receptors in MDMs. The level of significance was set as *p 0.05 considered significant, **p 0.01 considered highly significant, and ***p 0.001 considered highly significant. a—Significantly differed from the control group (*p 0.05; **p 0.01; ***p 0.001). b—Significantly differed from the LPS group (*p 0.05; **p 0.01; ***p 0.001).

The direct effect of live probiotic strains of L. reuteri B1/1 and L. fermentum CCM 7158 was investigated on IPEC-J2 cells, representing the apical compartment of the co-culture model. The results obtained from the gene expression of the pro-inflammatory cytokines IL-1β and IL-6 confirmed the anti-inflammatory effect of the used probiotic strain L. reuteri B1/1, as reflected by the down-regulation of these genes compared to the LPS group of IPEC-J2 cells (p 0.001) (Fig. 4). Although MDMs were not directly treated with probiotics, we also confirmed a down-regulation for the gene encoding IL-8 in cells treated with LF and LR (p 0.001) compared to the LPS experimental group (Fig. 5).

As a regulatory cytokine, we also investigated IL-10 expression, which was affected by probiotic bacterial culture of both LR and LF in both IPEC-J2 and MDMs, with statistical significance p 0.001 compared to the control group of cells in each culture (Figs. 4,5).

3.4 Transcriptional Response of TJ-Related Genes and Toll-Like Receptors in IPEC-J2 Cells and MDMs within the Co-Culture Model

The influence of LPS from E.coli was investigated in an in vitro co-culture model by gene expression analysis of genes related to TJ such as claudin-1 (CLDN1), lumican (LUM), olfactomedin-4 (OLFM-4) and occludin (OCLN). In the directly treated MDMs with LPS, the down-regulation of LUM and CLDN (p 0.01) was observed. Although the IPEC-J2 cells were not directly treated with LPS, a down-regulation of the investigated gene encoding OCLN (p 0.001) was detected in this undirectly induced group of cells compared to the control cell group (Fig. 4).

In LR probiotic-treated group of IPEC-J2 cells, an up-regulation of mRNA levels for genes encoding OLFM, LUM and CLDN1 was detected (p 0.001) compared to the control group, while an opposite trend was detected in LF-treated probiotic group. L. fermentum CCM 7158 affected cells in the direction of a decrease in the level of gene expression for the molecules CLDN1, LUM and OCLN (p 0.001) compared to the control (Fig. 4).

TLR4 mRNA levels were up-regulated in the LPS-induced group in the case of IPEC-J2 cells (p 0.001), but not in MDMs (Figs. 4,5), whereas TLR2 mRNA levels were up-regulated in MDMs (p 0.001), but in the IPEC-J2 cell line, the transcriptional response for TLR2 could not be evaluated due to low expression. However, in the case of TLR4 monitoring in IPEC-J2 and MDMs, an opposite trend was observed with the probiotic treatment. While the LR increased TLR4 expression in IPEC-J2 (p 0.001), there was no increased expression in MDMs. In contrast, LF treatment increased the mRNA level of TLR4 and TLR2 in indirectly treated MDMs (Fig. 5).

4. Discussion

In the body, the intestinal epithelium performs a number of important functions such as digesting and absorbing nutrients, providing a physical barrier, and shielding the body from the challenging conditions of the gut lumen. The epithelial barrier ensures selectivity, preventing the entry of a potentially harmful luminal contents by rejection, while facilitating the controlled absorption and secretion of significant amounts of solutes and water in a specific direction. Individual epithelial cells are linked through a network of intercellular junctions - TJs, which are of particular significance in defining the properties of the paracellular barrier and its selectivity [32]. To determine barrier strength, TEER is commonly measured in in vitro cell models and permeability to paracellular markers such as the enzyme horseradish peroxidase, inulin, or mannitol is assessed [33]. Our results showed that a basolateral challenge in the form of LPS had an effect on the reduction of TEER values already after 6 h of application. The fact that basolateral LPS challenge leads to a significant decrease in TEER was also demonstrated by Wine et al. [34], who found that the basolateral aspect of the T84 cell line by infection with invasive E. coli (O157:H7) led to a significant decrease in TEER values. This reduction was more significant after basolateral application compared to the apical compartment/application of E. coli. There is evidence that other pathogens, such as C. jejuni, enter intestinal epithelial cells through? the basolateral membrane, highlighting the importance of this finding [35].

Furthermore, it is well known that the intestinal barrier function is to some extent supported by TJ proteins [36]. Epithelial cell TJs are comprised of numerous junctional molecules, including claudins, occludins and zonula occludens, which regulate the paracellular permeability of various macromolecules, ions, and water between neighboring cells. Occludin is a key transmembrane protein in the TJs, and both occludin and claudin-1 play essential roles in maintaining the intestinal permeability and barrier function of the TJs. There is evidence that LPS-induced inflammation disrupts the integrity of intestinal epithelial cells and TJs [37]. Disruption of TJ integrity leads to immune cell activation and inflammatory processes in the affected tissues [38]. Consistent with the previous statement, in our study, basolateral application of LPS to MDMs affected the expression of the gene encoding OCLN which resulted in a significant down-regulation in IPEC-J2 cells representing the apical compartment. Similar results were reported by Zhao et al. [25], who observed a decrease in mRNA levels for the gene encoding OCLN after treating IPEC-J2 cells with bacterial LPS. Similarly, in the work of Wu et al. [37], a down-regulation of the expression of genes encoding the proteins occludin and claudin-1 was observed by applying LPS at a concentration of 1 µg/mL.

On the other hand, strong adhesion provides the initial interaction of probiotics with intestinal epithelial cells, which is key for LAB strains to exert their beneficial effects on host health. Adhesion to intestinal cells limits the presence of potential pathogens, thereby providing protection to intestinal epithelial cells (IECs) [39]. The genus Limosilactobacillus (līmōsus, Lat. - slimy), which also includes the strains L. reuteri and L. fermentum, is characterized by the ability of most strains in this genus to produce exopolysaccharides (EPS) from sucrose to promote biofilm formation on intestinal epithelia [40]. In this study, L. fermentum CCM 7158 was used as an indicator LAB strain because it is included in the Czech Collection of Microorganisms (CCM) and its properties have been extensively studied in previous studies under both in vitro and in vivo [41, 42, 43]. An interesting finding in our work is that simultaneous treatment of MDMs with LPS and treatment of IPEC-J2 with the probiotic strain L. fermentum CCM 7158 led to the down-regulation of mRNA for CLDN-1 and OCLN in intestinal cells. However, when L. reuteri B1/1 was used, the mRNA levels for the above-mentioned genes were significantly increased compared to the control group of cells. Similarly, genes encoding the antimicrobial proteins LUM and OLFM-4, which are also involved in maintaining the integrity of the intestinal epithelial layer [3], were significantly up-regulated in the IPEC-J2 cells treated with L. reuteri B1/1. In light of these results, we could suggest that L. reuteri B1/1 may act in a stimulatory manner on intestinal epithelia. Similarly, in our recent study, we observed the stimulatory effect of L. reuteri B1/1 on non-carcinogenic porcine-derived enterocytes (CLAB) at both concentrations used (107 and 109 CFU/mL) for mRNA transcription levels of lumican and olfactomedin-4 [30]. Likewise, in our other research under in vivo conditions, broiler chickens were orally exposed to L. reuteri B1/1 for 7 days, while also receiving a single dose of infectious Campylobacter jejuni on day 4. Specifically, in this experimental group we observed an increase in gene expression of the NLRP3 inflammasome along with other key immune molecules such as IL-1β, IL-18, and CASP-1 in the caecum. We hypothesize that this stimulation contributes to an improved ability of the innate immune system to more effectively countert Campylobacter jejuni infection in broiler chickens [44].

At the same time, enterocytes are an important component of the highly regulated communication network that provides protection to the intestinal mucosa, their ability to recognize microorganisms via pattern recognition receptors (PRRs) is essential [45]. The best-known of these PRRs are the Toll-like receptors (TLRs). Interaction of microorganisms with TLRs either leads to activation and triggering of the signaling pathway or, conversely, blocks its activation through the mechanism of negative regulators [46]. Structural components of the LAB cell wall, as well as the EPS, can be produced and released into the surrounding environment and are capable of interacting with TLRs in the gut [47]. In our previous study with the IPEC-J2/moDCs co-culture model, we demonstrated the ability of EPS derived from L. reuteri Biocenol™ to increase mRNA levels in dendritic cell monocultures [16]. In the present work we used live lactobacilli, where by treating apically deposited IPEC-J2 cells with L. fermentum CCM 7158, we observed an increase in gene expression for the gene encoding the TLR4 receptor not only in directly treated enterocytes but also in basolaterally deposited MDMs. Although the gene encoding TLR2 could not be captured in IPEC-J2 due to the reduced gene expression levels, the expression of this gene was increased in MDMs. This up-regulation in basolaterally deposited macrophages correlates with the detected increased expression of the pro-inflammatory cytokines studied (IL-1β, IL-6, IL-18), precisely in this experimental group. We hypothesize that this increase in genes encoding TLR receptors implies an active maintenance of the host’s vigilance against pathogens. Our results are not surprising, as it is well-known that TLR signaling triggers an initial cytokine reaction which intensifies the inflammatory response in the host while engaging other cells in the fight against infectious agents. Macrophages participate in cytokine production following their TLR9, TLR2, and TLR4 activation by releasing cytokines such as IL-12, IL-1β, IL-6, and IL-10 [48, 49, 50].

Numerous studies have demonstrated that LPS disrupts the structural integrity of the intestinal epithelia, triggers inflammation, and leads to the release of inflammatory cytokines such as IL-1β, IL-8, IL-6, and TNF-α [51, 52, 53]. The results obtained in our study by monitoring the mRNA transcriptional levels of pro-inflammatory cytokines (IL-8, IL-1β, IL-6, IL-18) in the LPS-induced experimental group indicate an increased release of cytokines by each cell type. Similarly, previous studies have shown that LPS is able to induce inflammation in intestinal epithelial cells, as manifested by increased levels of the pro-inflammatory cytokines monitored [54, 55, 56]. When comparing transcriptional levels of the studied pro-inflammatory cytokines in cells exposed to LPS and cells treated with L. reuteri B1/1, it is evident that the simultaneous treatment of IPEC-J2 cells with LAB and LPS challenge of MDMs significantly suppressed the inflammation induced by LPS alone without probiotic treatment. However, an interesting finding of our work was the different cellular responses of both IPEC-J2 and MDMs to the two LAB strains used. While L. reuteri B1/1 had the potential to increase the expression of genes encoding the antimicrobial peptides LUM and OLFM-4, as well as genes encoding TJ-related genes (CLDN-1 and OCLN), we did not observe these effects in the case of L. fermentum CCM 7158. On the contrary, L. fermentum CCM 7158 was able to increase the mRNA levels of pro-inflammatory cytokines (IL-18, IL-6, and IL-1β) in indirectly treated MDMs. Along with evaluating the gene expression of pro-inflammatory cytokines, IL-10 and an essential anti-inflammatory cytokine were also assessed. IL-10 plays a pivotal role in preserving gut homeostasis, the fine balance between inflammation processes triggered by pathogens, and plays a role in facilitating immunoregulatory mechanisms triggered by probiotics as well [57, 58]. In our experiment, cells from both the apical and basolateral compartments showed increased gene expression for this anti-inflammatory cytokine for both probiotic strains used and applied to IPEC-J2 cells. Although production of the anti-inflammatory cytokine IL-10 was observed in both LAB strains used in both cell cultures, we hypothesize that L. fermentum CCM 7158 has both an anti-inflammatory and immunostimulatory potential, as it was able to increase pro-inflammatory cytokines when co-induced with LPS in DMD cells. Similarly, in the study by Huang et al. [59], the strain E. faecium EF1 was found to exhibit both anti-inflammatory and immunostimulatory activities after oral administration in suckling piglets. The simultaneous anti- and pro-inflammatory properties of probiotics have also been demonstrated in several other in vitro studies [60, 61]. However, it must be taken into account that different strains of probiotics have different effects on cellular activity, cytokine release, and immunological interactions. Therefore, it is important to test bacterial strains under in vitro conditions, which allows the identification/elimination of toxic bacteria in order to reduce the number of preclinical tests performed on animals [62].

5. Conclusions

In our current study, using the porcine intestine in vitro model by co-cultivating IPEC-J2 and MDMs, we investigated the immunomodulatory potential of a recently isolated LAB strain L. reuteri B1/1 and the indicator LAB strain L. fermentum CCM 7158 on the inflammatory response to LPS challenge. An in vitro immunoprotective potential of L. reuteri B1/1 was suggested as it was able to suppress the enhanced inflammatory response of both cells used to LPS challenge. On the contrary, L. fermentum CCM 7158 increased the mRNA levels of pro-inflammatory cytokines (IL-18, IL-6, and IL-1β) in indirectly treated MDMs when LPS was simultaneously applied to basolaterally deposited macrophages. Although the production of the anti-inflammatory cytokine IL-10 was observed in both LAB strains used in both cell cultures, we hypothesize that L. fermentum has both anti-inflammatory and immunostimulatory effects. In addition, we demonstrated the ability of L. reuteri B1/1 to up-regulate the mRNA levels of genes encoding the antimicrobial proteins LUM and OLFM-4 in directly treated IPEC-J2 cells. Moreover, L. reuteri B1/1 was able to increase the TJ-related genes CLDN1 and OCLN, which were significantly down-regulated by the LPS challenge. Our results suggest that the recently isolated LAB strain L. reuteri B1/1 could have the potential to alleviate LPS-induced epithelial disruption and influence the production of antimicrobial molecules by enterocytes. Additional research is required to enhance our understanding of how L. reuteri B1/1 influences host mucosal immunity, and the mechanism of action for potential commercial use of this new probiotic lactobacillus isolate.

Availability of Data and Materials

All data from this study are included in the manuscript or are available on request from the first or corresponding author.

Author Contributions

Conceptualization, ZK, VK, JS and DM; Methodology, Data curation, ZK and JS; Formal analysis, Writing - Original draft preparation, ZK and VK; Supervision, DM; The cell cultures were prepared by ZK, and JS; Writing - Review and Editing ZK and VK; The management for research activity planning and the financial support for the project leading to this publication was performed by VK and DM. All authors read and approved the final manuscript. All authors have participated sufficiently in the work to take public responsibility for appropriate portions of the content and agreed to be accountable for all aspects of the work in ensuring that questions related to its accuracy or integrity. All authors contributed to editorial changes in the manuscript.

Ethics Approval and Consent to Participate

The procedure of blood sampling was performed in accordance with the guidelines for animal welfare and was approved by the Ethics Committee for the approval of research involving animals by the legislative requirements applicable at the UVMP in Košice with permit No. EKVP/2023-04.

Acknowledgment

We are grateful to assoc. prof. Jaroslav Novotný, DVM, PhD, from the Clinic of Swine, from the University of Veterinary Medicine and Pharmacy in Košice, for providing blood samples from which the monocyte-derived macrophages were isolated.

Funding

This work was funded by the Slovak Research and Development Agency under the contract no. (APVV-21-0129) and the Scientific Grant Agency of the Ministry of Education, Science, Research and Sport of the Slovak Republic VEGA 1/0098/22.

Conflict of Interest

The authors declare no conflict of interest.

References
[1]
Manyi-Loh C, Mamphweli S, Meyer E, Okoh A. Antibiotic Use in Agriculture and Its Consequential Resistance in Environmental Sources: Potential Public Health Implications. Molecules (Basel, Switzerland). 2018; 23: 795.
[2]
Pan D, Yu Z. Intestinal microbiome of poultry and its interaction with host and diet. Gut Microbes. 2014; 5: 108–119.
[3]
Karamanou K, Perrot G, Maquart FX, Brézillon S. Lumican as a multivalent effector in wound healing. Advanced Drug Delivery Reviews. 2018; 129: 344–351.
[4]
Cárdenas-León CG, Klaas M, Mäemets-Allas K, Arak T, Eller M, Jaks V. Olfactomedin 4 regulates migration and proliferation of immortalized non-transformed keratinocytes through modulation of the cell cycle machinery and actin cytoskeleton remodelling. Experimental Cell Research. 2022; 415: 113111.
[5]
González-Mariscal L, Betanzos A, Nava P, Jaramillo BE. Tight junction proteins. Progress in Biophysics and Molecular Biology. 2003; 81: 1–44.
[6]
Hartsock A, Nelson WJ. Adherens and tight junctions: structure, function and connections to the actin cytoskeleton. Biochimica et Biophysica Acta. 2008; 1778: 660–669.
[7]
Alagawany M, Elnesr SS, Farag MR, Abd El-Hack ME, Barkat RA, Gabr AA, et al. Potential role of important nutraceuticals in poultry performance and health - A comprehensive review. Research in Veterinary Science. 2021; 137: 9–29.
[8]
Jiang J, Li K, Xiao Y, Zhong A, Tang J, Duan Y, Li Z. Limosilactobacillus reuteri regulating intestinal function: a review. Fermentation. 2022; 9: 19.
[9]
Ruemmele FM, Bier D, Marteau P, Rechkemmer G, Bourdet-Sicard R, Walker WA, et al. Clinical evidence for immunomodulatory effects of probiotic bacteria. Journal of Pediatric Gastroenterology and Nutrition. 2009; 48: 126–141.
[10]
Cristofori F, Dargenio VN, Dargenio C, Miniello VL, Barone M, Francavilla R. Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. Frontiers in Immunology. 2021; 12: 578386.
[11]
Liu Q, Yu Z, Tian F, Zhao J, Zhang H, Zhai Q, et al. Surface components and metabolites of probiotics for regulation of intestinal epithelial barrier. Microbial Cell Factories. 2020; 19: 23.
[12]
Chopyk DM, Grakoui A. Contribution of the Intestinal Microbiome and Gut Barrier to Hepatic Disorders. Gastroenterology. 2020; 159: 849–863.
[13]
Díez-Solinska A, Vegas O, Azkona G. Refinement in the European Union: A Systematic Review. Animals: an Open Access Journal from MDPI. 2022; 12: 3263.
[14]
Kiššová Z, Tkáčiková Ľ, Mudroňová D, Bhide MR. Immunomodulatory Effect of Lactobacillus reuteri (Limosilactobacillus reuteri) and Its Exopolysaccharides Investigated on Epithelial Cell Line IPEC-J2 Challenged with Salmonella Typhimurium. Life (Basel, Switzerland). 2022; 12: 1955.
[15]
Young L, Sung J, Stacey G, Masters JR. Detection of Mycoplasma in cell cultures. Nature Protocols. 2010; 5: 929–934.
[16]
Kiššová Z, Mudroňová D, Link R, Tkáčiková Ľ. Immunomodulatory effect of probiotic exopolysaccharides in a porcine in vitro co-culture model mimicking the intestinal environment on ETEC infection. Veterinary Research Communications. 2024; 48: 705–724.
[17]
Raymond CR, Wilkie BN. Toll-like receptor, MHC II, B7 and cytokine expression by porcine monocytes and monocyte-derived dendritic cells in response to microbial pathogen-associated molecular patterns. Veterinary Immunology and Immunopathology. 2005; 107: 235–247.
[18]
Liu J, Tian ZY, Xiao YC, Wang XL, Jin ML, Shi DS. The Role of Porcine Monocyte Derived Dendritic Cells (MoDC) in the Inflammation Storm Caused by Streptococcus suis Serotype 2 Infection. PloS One. 2016; 11: e0151256.
[19]
Nedumpun T, Ritprajak P, Suradhat S. Generation of potent porcine monocyte-derived dendritic cells (MoDCs) by modified culture protocol. Veterinary Immunology and Immunopathology. 2016; 182: 63–68.
[20]
Moue M, Tohno M, Shimazu T, Kido T, Aso H, Saito T, et al. Toll-like receptor 4 and cytokine expression involved in functional immune response in an originally established porcine intestinal epitheliocyte cell line. Biochimica et Biophysica Acta. 2008; 1780: 134–144.
[21]
Cinar MU, Islam MA, Uddin MJ, Tholen E, Tesfaye D, Looft C, et al. Evaluation of suitable reference genes for gene expression studies in porcine alveolar macrophages in response to LPS and LTA. BMC Research Notes. 2012; 5: 107.
[22]
Kšonžeková P, Bystrický P, Vlčková S, Pätoprstý V, Pulzová L, Mudroňová D, et al. Exopolysaccharides of Lactobacillus reuteri: Their influence on adherence of E. coli to epithelial cells and inflammatory response. Carbohydrate Polymers. 2016; 141: 10–19.
[23]
Shabir N, Khatun A, Nazki S, Gu S, Lee SM, Hur TY, et al. In vitro immune responses of porcine alveolar macrophages reflect host immune responses against porcine reproductive and respiratory syndrome viruses. BMC Veterinary Research. 2018; 14: 380.
[24]
Dang Y, Lachance C, Wang Y, Gagnon CA, Savard C, Segura M, et al. Transcriptional approach to study porcine tracheal epithelial cells individually or dually infected with swine influenza virus and Streptococcus suis. BMC Veterinary Research. 2014; 10: 86.
[25]
Zhao L, Li M, Sun K, Su S, Geng T, Sun H. Hippophae rhamnoides polysaccharides protect IPEC-J2 cells from LPS-induced inflammation, apoptosis and barrier dysfunction in vitro via inhibiting TLR4/NF-κB signaling pathway. International Journal of Biological Macromolecules. 2020; 155: 1202–1215.
[26]
Yoon JW, Shin S, Park J, Lee BR, Lee SI. TLR/MyD88-Mediated Inflammation Induced in Porcine Intestinal Epithelial Cells by Ochratoxin A Affects Intestinal Barrier Function. Toxics. 2023; 11: 437.
[27]
Byrne KA, Tuggle CK, Loving CL. Differential induction of innate memory in porcine monocytes by β-glucan or bacillus Calmette-Guerin. Innate Immunity. 2021; 27: 448–460.
[28]
Liu M, Wang Q, Wu W, Chen M, Zhang P, Guo M, et al. Glaesserella parasuis serotype 5 breaches the porcine respiratory epithelial barrier by inducing autophagy and blocking the cell membrane Claudin-1 replenishment. PLoS Pathogens. 2022; 18: e1010912.
[29]
Xun W, Shi L, Zhou H, Hou G, Cao T. Effect of weaning age on intestinal mucosal morphology, permeability, gene expression of tight junction proteins, cytokines and secretory IgA in Wuzhishan mini piglets. Italian Journal of Animal Science. 2018; 17: 976–983.
[30]
Karaffová V, Teleky J, Pintarič M, Langerholc T, Mudroňová D, Hudec E, et al. Application of Lactobacillus reuteri B1/1 (Limosilactobacillus reuteri) Improves Immunological Profile of the Non-Carcinogenic Porcine-Derived Enterocytes. Life (Basel, Switzerland). 2023; 13: 1090.
[31]
Sharma B, Luhach K, Kulkarni GT. In vitro and in vivo models of BBB to evaluate brain targeting drug delivery systems: a focus on nanotechnology and nanoparticulates. Academic Press: MA, USA. 2018.
[32]
Ma TY, Nighot P, Al-Sadi R. Tight junctions and the intestinal barrier. Physiology of the gastrointestinal tract (pp. 587–639). 6th edn. Academic Press: MA, USA. 2018.
[33]
Srinivasan B, Kolli AR, Esch MB, Abaci HE, Shuler ML, Hickman JJ. TEER measurement techniques for in vitro barrier model systems. Journal of Laboratory Automation. 2015; 2:107–126.
[34]
Wine E, Ossa JC, Gray-Owen SD, Sherman PM. Adherent-invasive Escherichia coli, strain LF82 disrupts apical junctional complexes in polarized epithelia. BMC Microbiology. 2009; 9: 180.
[35]
Monteville MR, Konkel ME. Fibronectin-facilitated invasion of T84 eukaryotic cells by Campylobacter jejuni occurs preferentially at the basolateral cell surface. Infection and Immunity. 2002; 70: 6665–6671.
[36]
Capaldo CT, Powell DN, Kalman D. Layered defense: how mucus and tight junctions seal the intestinal barrier. Journal of Molecular Medicine (Berlin, Germany). 2017; 95: 927–934.
[37]
Wu J, He C, Bu J, Luo Y, Yang S, Ye C, et al. Betaine attenuates LPS-induced downregulation of Occludin and Claudin-1 and restores intestinal barrier function. BMC Veterinary Research. 2020; 16: 75.
[38]
Suzuki T. Regulation of the intestinal barrier by nutrients: The role of tight junctions. Animal Science Journal. 2020; 91: e13357.
[39]
Guan C, Chen X, Jiang X, Zhao R, Yuan Y, Chen D, et al. In vitro studies of adhesion properties of six lactic acid bacteria isolated from the longevous population of China. RSC Advances. 2020; 10: 24234–24240.
[40]
Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. International Journal of Systematic and Evolutionary Microbiology. 2020; 70: 2782–2858.
[41]
Capcarova M, Weiss J, Hrncar C, Kolesarova A, Pal G. Effect of Lactobacillus fermentum and Enterococcus faecium strains on internal milieu, antioxidant status and body weight of broiler chickens. Journal of Animal Physiology and Animal Nutrition. 2010; 94: e215–e224.
[42]
Hrnčár C, Weis J, Baraňska B, Malíková L, Petričová Ľ. The Effect of different probiotic strains on fattening and carcass parameters of broiler ducks. Journal of Microbiology, Biotechnology and Food Sciences. 2013; 2: 1155–1163.
[43]
Mudroňová D, Nemcová R, Laukova A, Koščová J, Strompfová V, Katarína G, et al. Effect of Lactobacillus fermentum alone, and in combination with zinc (II) propionate on Salmonella enterica serovar Dusseldorf in Japanese quails. Biologia. 2006; 61: 797–801.
[44]
Karaffová V, Revajová V, Koščová J, Gancarčíková S, Nemcová R, Ševčíková Z, et al. Local intestinal immune response including NLRP3 inflammasome in broiler chicken infected with Campylobacter jejuni after administration of Lactobacillus reuteri B1/1. Food and Agricultural Immunology. 2020; 31: 937–949.
[45]
Kagnoff MF. The intestinal epithelium is an integral component of a communications network. The Journal of Clinical Investigation. 2014; 124: 2841–2843.
[46]
Gao D, Li W. Structures and recognition modes of toll-like receptors. Proteins. 2017; 85: 3–9.
[47]
Oerlemans MMP, Akkerman R, Ferrari M, Walvoort MTC, de Vos P. Benefits of bacteria-derived exopolysaccharides on gastrointestinal microbiota, immunity and health. Journal of Functional Foods. 2021; 76: 104289.
[48]
Strieter RM, Belperio JA, Keane MP. Host innate defenses in the lung: the role of cytokines. Current Opinion in Infectious Diseases. 2003; 16: 193–198.
[49]
Hoogerwerf JJ, de Vos AF, van’t Veer C, Bresser P, de Boer A, Tanck MWT, et al. Priming of alveolar macrophages upon instillation of lipopolysaccharide in the human lung. American Journal of Respiratory Cell and Molecular Biology. 2010; 42: 349–356.
[50]
Juarez E, Nuñez C, Sada E, Ellner JJ, Schwander SK, Torres M. Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes. Respiratory Research. 2010; 11: 2.
[51]
Cao S, Zhang Q, Wang C, Wu H, Jiao L, Hong Q, et al. LPS challenge increased intestinal permeability, disrupted mitochondrial function and triggered mitophagy of piglets. Innate Immunity. 2018; 24: 221–230.
[52]
Wu W, Wang S, Liu Q, Wang X, Shan T, Wang Y. Cathelicidin-WA attenuates LPS-induced inflammation and redox imbalance through activation of AMPK signaling. Free Radical Biology & Medicine. 2018; 129: 338–353.
[53]
Gao Z, Liu X, Wang W, Yang Q, Dong Y, Xu N, et al. Characteristic anti-inflammatory and antioxidative effects of enzymatic- and acidic- hydrolysed mycelium polysaccharides by Oudemansiella radicata on LPS-induced lung injury. Carbohydrate Polymers. 2019; 204: 142–151.
[54]
Sargeant HR, Miller HM, Shaw MA. Inflammatory response of porcine epithelial IPEC J2 cells to enterotoxigenic E. coli infection is modulated by zinc supplementation. Molecular Immunology. 2011; 48: 2113–2121.
[55]
Dong N, Xu X, Xue C, Wang C, Li X, Bi C, et al. Ethyl pyruvate inhibits LPS induced IPEC-J2 inflammation and apoptosis through p38 and ERK1/2 pathways. Cell Cycle (Georgetown, Tex.). 2019; 18: 2614–2628.
[56]
Qiu Y, Yang X, Wang L, Gao K, Jiang Z. L-Arginine Inhibited Inflammatory Response and Oxidative Stress Induced by Lipopolysaccharide via Arginase-1 Signaling in IPEC-J2 Cells. International Journal of Molecular Sciences. 2019; 20: 1800.
[57]
Kaji R, Kiyoshima-Shibata J, Tsujibe S, Nanno M, Shida K. Short communication: Probiotic induction of interleukin-10 and interleukin-12 production by macrophages is modulated by co-stimulation with microbial components. Journal of Dairy Science. 2018; 101: 2838–2841.
[58]
Sheil B, MacSharry J, O’Callaghan L, O’Riordan A, Waters A, Morgan J, et al. Role of interleukin (IL-10) in probiotic-mediated immune modulation: an assessment in wild-type and IL-10 knock-out mice. Clinical and Experimental Immunology. 2006; 144: 273–280.
[59]
Huang Y, Li YL, Huang Q, Cui ZW, Yu DY, Rajput IR, et al. Effect of orally administered Enterococcus faecium EF1 on intestinal cytokines and chemokines production of suckling piglets. Pakistan Veterinary Journal. 2012; 32: 2074–7764.
[60]
de Moreno de LeBlanc A, Chaves S, Carmuega E, Weill R, Antóine J, Perdigón G. Effect of long-term continuous consumption of fermented milk containing probiotic bacteria on mucosal immunity and the activity of peritoneal macrophages. Immunobiology. 2008; 213: 97–108.
[61]
Haller D, Bode C, Hammes WP, Pfeifer AM, Schiffrin EJ, Blum S. Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures. Gut. 2000; 47: 79–87.
[62]
Huang W, Percie du Sert N, Vollert J, Rice ASC. General Principles of Preclinical Study Design. Handbook of Experimental Pharmacology. 2020; 257: 55–69.

Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share
Back to top