Synthesis and characterization of F1 with five attached residues of potassium salt of 2-(phenylthio)acetic acid and a hydrogen atom attached to the cage (acetic acid, 2,2^′,2^′′,2^′′′,2^′′′′-[(8-chloro[5,6]fullerene-C 60 -Ih-1,7,11,24,27(8H)-pentayl)pentakis(4,1-phenylenethio)]pentakis-, potassium salt (1:5)) was described in detail previously by our group [21] and a brief description is provided in Supplementary Material 1. This compound demonstrated a marked inhibitory activity against three distinct types of lung cancer cell lines at a concentration of 400 µM. In particular, at this concentration, it sufficiently reduced the survival rate of lung cancer cell lines A549, H460, H1299 below ~56% [20]. At the same time, this compound was not toxic to normal cells. Thus, this compound can be considered one of the most promising fullerene-based compounds with antitumor activity.

The modified fullerene was presented in the form of a dry brown powder, which was subsequently dissolved in distilled water.

The Research Centre for Medical Genetics (RCMG) provided the fourth passage of human embryonic lung fibroblasts (HELF). Cells were seeded with a density of 1.7 $\times$ 10.4 per 1 mL of DMEM medium (Paneko, Moscow, Russia) with 10% embryonic veal serum (PAA Laboratories, Vienna, Austria), 50 U/mL of penicillin, 50 µg/mL of streptomycin and 10 µg/mL of gentamicin (Sigma-Aldrich, St.Louis, MO, USA) and cultivated at 37 °C and 5% CO₂. Cell line was validated by short tandem repeat (STR) profiling and tested negative for mycoplasma. F1 was dissolved under sterile conditions in saline solution. Following the addition of the functionalized fullerene to the medium, the cells underwent incubation periods spanning from 30 minutes to 24 hours.

Cells were cultured in a 96-well plate for a period of 24 hours. The viability of the cells was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. After a period of 24 hours, the medium was decanted from the culture plate. Subsequently, 100 µL of a diluted MTT solution (Sigma-Aldrich, St. Louis, MO, USA) was added to each well. The MTT concentration was 5 mg of dye per 1 ml of sterile water. The cells were then incubated for 1 to one 1.5 hours at 37 °C in an atmosphere containing 5% CO₂. Following the incubation period, all contents of the plate were removed, and 100 mL of dimethyl sulfoxide (DMSO) were added to each well, which were then incubated in a refrigerator at +5 °C for 15 min. Living cells exhibit a blue coloration of their mitochondria. The results of the test were analyzed at a wavelength of 550 nm using an EnSpire Plate Reader (EnSpire Equipment, Turku, Finland).

ROS analysis was performed using flow cytometry and fluorescence microscopy. Approximately 8 $\times$ 10³ cells were incubated in 96-well plates with F1 and washed with PBS. Then they were treated with a 10 µM solution of H2DCFHDA in PBS (Molecular Probes/Invitrogen, Carlsbad, CA, USA). The total fluorescent signal was analyzed at $\lambda$ex = 503 nm and $\lambda$em = 524 nm using a Cyflow cytofluorometer (Sysmex Partec, Görlitz, Germany). The rate constant of the 2^′,7^′-dichlorofluorescein (DCF) formation reaction (k) was calculated using a dependence of the DCF signal intensity on the incubation time with H2DCFHDA. Data are presented as the k₁/k₀ ratio, where k₁ and k₀ are the rates of DCF formation in exposed and non-exposed cells, respectively.

The cells (approximately 50 $\times$ 10³) were subjected to a series of washes using 0.5% bovine serum albumin phosphate-buffered saline (BSA-PBS) solution. Following this, they were treated with conjugated antibodies (1 µg/mL) for a duration of two hours at a temperature of 20 °C. This process was then followed by further washes with 0.5% BSA-PBS solution. The antibodies employed in this study included dyLight488-$\gamma$$\gamma$H2AX (pSer139) (nb100-78356G NovusBio, Saint Louis, CO, USA); CY5.5-NADPH oxidase 4 (NOX4) (bs-1091r-cy5-5, Bioss Inc., Woburn, MA, USA); PE-8OHdG (sc-393871 PE, Santa Cruz, Dallas, TX, USA); NF-E2-related factor 2 (NRF2) pSer40 (bs2013 Bioss Inc., Woburn, MA, USA); and proliferating cell nuclear antigen (PCNA) antibody, sourced from Abcam (ab2426, Abcam Inc., Waltham, MA, USA) [22]. The level of protein production was quantified using the software of a flow cytometer (CytoFlex S, Beckman Coulter, Pasadena, CA, USA). To do so, the total fluorescence intensity of specifically labelled cells was compared to the total fluorescence of control cells.

RNA was extracted from the cells using YellowSolve kits (Klonogen, St. Petersburg, Russia). This was followed by a phenol-chloroform extraction procedure and precipitation using chloroform and isoamyl alcohol in a ratio of 49:1. The concentration of RNA was determined using Quant-iT RiboGreen reagent produced by MoBiTec in Göttingen, Germany on a tablet reader (EnSpire Equipment, Turku, Finland). The $\lambda$em and $\lambda$fl values were set at 487 and 524 nanometers, respectively. The reverse transcription reaction was carried out using Sileks reagents from Moscow, Russia. PCR was performed with appropriate primers (Syntol, Moscow, Russia) and Sybr Green intercalating dye was used on a StepOnePlus instrument (Applied Biosystems, Foster City, CA, USA). PCR conditions were tailored individually for each primer pair. Gene expression analysis was conducted in multiple independent experiments, with results processed using a calibration curve. TBP served as a reference gene.The following primers were used (Sintol, Russia): BRCA1 (F: TGTGAGGCACCTGTGGTGA, R: CAGCTCCTGGCACTGGTAGAG); NRF2 (NFE2 L2) (F: TCCAGTCAGAAACCAGTGGAT, R: GAATGTCTGCGCCAAA AGCTG); BRCA2 (F: CCTCTGCCCTTATCATCACTTT; R: CCAGATGATGTCTT CTCCATCC); CCND1 (F: TTCGTGGCCTCTAAGATGA AGG; R: GAGCAGCTCCATTTGCAGC) BCL2 (F: TTTGGAAATCCGACCACTAA; R: AAAGAAATGCAAGTGAATGA); BAX (F: CCCGAGAGGTCTTTTTCCGAG, R: CCAGCCCATGATGGTTCTGAT); and TBP (reference gene) (F: GCCCGAAACGCCGAATAT, R: CCGTGGTTCGTGGCTCTCT). The amount of RNA of each gene is the average value (three experiments) of the expression of this gene, related to the expression of the internal standard gene (TBP) in the presence of fullerene derivatives in relation to the expression of each gene (also related to the expression of the internal standard gene) in the control. To elucidate, the expression level of the target gene in relation to the expression of an internal standard gene, TBP, in a control (in cells cultured without fullerenes), is set at 1.

Fluorescence microscopy was conducted using an AxioScope A1 fluorescence microscope (Carl Zeiss, Oberkochen, Germany) and the CyTell cellular imaging system (GE Healthcare, Buckinghamshire, UK).

The irradiation was performed in a medium maintained at a temperature of 20 °C using a pulsed X-ray generator (ARINA-2, Spectroflash, Russia). The X-ray tube voltage was approximately 160 kilovolts (kV), with a peak energy in the X-ray spectrum of approximately 60 keV. The dose rate was set at 1 gray (Gy) per minute. The control cells remained unirradiated.

The comet assays were carried out as follows. A cell suspension in low-melting-point agarose was dropped onto slides that had precoated with 1% normal-melting-point agarose. These slides then immersed in a solution containing10 mM Tris-HCl, pH 10, 2.5 M NaCl, 100 mM EDTA, 1% Triton X-100, 10% DMSO at 4 °C for 1 hour. After that, the slides were transferred to electrophoresis buffer comprising 300 mM NaOH and 1 mM EDTA at pH greater than 13. Electrophoresis was performed for 20 min at 1 V/cm, 300 mA. The slides were fixed in 70% ethanol and stained using SYBR Green I (Invitrogen, USA).

The statistical significance of the observed discrepancies was assessed through the use of nonparametric Mann-Whitney U tests. p values less than 0.01 were deemed statistically significant and have been marked in the figures using the symbol “*”. The data were analysed using the professional software package StatPlus 2007 (http://www.analystsoft.com).

The effect of fullerene derivative [C60], F1 (C60[C6H4SCH2COOK]5H, Fig. 1), molecular weight 1748.13 g/mol) on human fetal lung fibroblasts (HELF) was studied. To assess the cytotoxicity of the studied compound, a standard MTT test was performed. The test reaction is the reduction of colorless 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) by mitochondrial and cytoplasmic dehydrogenases to purple formazan, which confirms the presence of living and functioning cells. The formation of formazan is detected with spectrophotometry. Incubation of cells with a fullerene derivative F1 was carried out for 24 and 72 hours. Fullerene showed no toxicity in the range from 0.3 pg/mL to 0.3 mg/mL (Fig. 2A) neither after 24 hours nor after 72 hours, this is the most nontoxic of all the fullerene derivatives we studied earlier [13, 14, 23, 24]. At the same time, after 72 hours in the concentration range of 3 ng/mL–3 mg/mL, an increase in cell survival was observed by 20–40% relative to the control cells cultured without fullerene (Fig. 2A).

Fig. 1.

Molecular formula of fullerene derivative F1.

Fig. 2.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-test and fluorescence images of HELFs incubated with fullerene derivative F1. (A) 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-test. The absorbance at 570 nm vs concentration of fullerene derivative F1. The green curve is for control, the blue curve is for F1 action. (B) The excitation spectrum of an aqueous solution of fullerene F1 (left) and fluorescence spectrum of an aqueous solution of fullerene F1 (right). (C) Fluorescence images of HELFs (40$\times$) incubated with fullerene derivative F1 (0.3 mg/mL) for 1 and 14 h in transmitted light (left), fluorescence (middle), and merged mode (right). Excitation filter: 575–645 nm. Emission filter: 530–555 nm. The bottom row is a control (left and center) and an enlarged ($\times$100) image of the cell nucleus, colored F1, in the center of the nucleus is visible the unpainted part of the nucleolar organizer (NOR). Scale bars = 20 µm or 10 µm. (D) Flow cytometry detection fullerene derivative F1. Median signal intensity of FL3-FL4 after 24 hours of cultivation with fullerene derivative F1 (the concentrations of F1 are shown in the figure; mean value for three independent experiments). Median values of FL3 and FL4 signal in non-fixed cells vs. concentration after 24 hours of cultivation of HELF with F1. *p 0.01, non-parametric Mann-Whitney U-tests.

An aqueous solution of fullerene derivative F1 under UV irradiation (wavelength 300–400 nm with a maximum of 370 nm) has a bright dark red fluorescence (with a maximum of 630 nm). Fig. 2B shows the excitation and fluorescence spectra of an aqueous fullerene solution at a concentration of 0.1 mg/mL. We used the ability of compound F1 to fluoresce to analyze its penetration and localization in cultivated HELFs.

The localization of fullerene in cells was analyzed using an AxioVert fluorescence microscope (Carl Zeiss, Germany) and a high-resolution video camera. Within 1 hour under HELF culture conditions, fullerene derivative F1 penetrates through the cell and nuclear membrane, accumulating in the nucleus. The localization of fullerene in cells is indicated by dark red fluorescent spots observed at a wavelength of 350 nm (Fig. 2C). After 24 hours, fullerene derivative F1 accumulates even more in the nucleus without staining the structure of the nucleoli (Fig. 2C).

This is the only water-soluble derivative of fullerene [C60] from all previously studied by us, penetrating through the nuclear membrane [13, 14, 23, 24].

The data obtained during the study of fullerene fluorescence by microscopy are fully confirmed by the data obtained using the flow cytometry (FCA) method. In unfixed cells, the increase in fluorescence is most noticeable at an excitation wavelength of 375 nm when using FL4-FL4 filters. The fluorescence signal of fullerene in cells increases with an increase in the concentration of compounds (Fig. 2D).

Thus, it was shown that the fullerene derivative F1 has red fluorescence under UV irradiation, within 1 to 24 hours the F1 compound penetrates through the cell and nuclear membrane of HELF, localizes in the nucleus, which makes it possible to use this water-soluble fullerene derivative as a vital dye for detecting the nucleus in living cells. Due to the property of this compound to detect the nucleus in living cells, combined with its low toxicity even in high concentrations, fullerene derivative F1 may be in demand in the future as a dye in the practice of laboratory work. But before recommending the fullerene derivative F1 as a vital dye, it is necessary to investigate its effect on the level of oxidative stress and the stability of nuclei.

The cytoplasm, the cell membrane and the nucleus serve as sites for the production of reactive oxygen species (ROS) in a living cell. Furthermore, cells generate hydrogen peroxide molecules in the extracellular environment. ROS plays a crucial role in various cellular processes such as proliferation, apoptosis and intercellular communication. However, excessive production of ROS by cells can lead to cell death or cellular damage. This phenomenon occurs when intracellular mechanisms are disrupted or when external factors are present. The level of ROS production in cells was assessed using the compound H2DCFH-DA, which penetrates the cytoplasm through cell membranes and is rapidly hydrolyzed by cellular hydrolases into DCFH. Non-fluorescent DCFH is then oxidized by ROS to form intensely fluorescent DCF, serving as a sensitive indicator of oxidative stress within the cell.

Fig. 3B shows the dependences of the DCF synthesis rate constants in cells at a fullerene F1 concentration of 0.3 mg/mL after 0.5, 1, 3, and 24 hours of incubation of cells with fullerene. Compound F1 0.5–1 hour after addition to the cell culture medium contributes to a slight increase in ROS synthesis, and a decrease in ROS levels is observed in cells 3 and 24 hours after the addition of F1 (Fig. 3A,B). At the same time, using the fluorescence microscopy method, it can be observed that within 1 hour after the addition of F1 to the culture medium, it is localized in the nuclei of most cells, while high ROS synthesis is observed both in the cytoplasm and in the HELF nuclei (Fig. 3A). Previously, under the action of water-soluble fullerene derivatives, we noted a short-term or long-term decrease in the level of ROS in cultured cells [13, 14, 22, 23, 25, 26]. The increase in the level of ROS under the action of F1 turned out to be a surprise for us since we expected that F1 would bind free radicals in cells and the level of ROS would decrease. Previously, we observed a secondary increase in the ROS level after an early decline, but not vice versa [13, 14]. We tried to figure out what could be the reason for the decrease in ROS in HELF 3 and 24 hours after the addition of F1 if F1 did not show the properties of a free radical acceptor even in the first hour after its introduction into the HELF culture medium.

Fig. 3.

The reactive oxygen species (ROS) level measured by fluorescence microscopy, ratio of I (DCF) change rate, dynamic change of average fluorescence intensity of 8-oxodG and NOX4. (A) The ROS level measured by fluorescence microscopy (40$\times$) 1h after cultivation cells with F1 (0.3 mg/mL) (1) compared to the control – cells without the addition of F1 (2). Scale bars = 20 µm. (B) Ratio of I (DCF) change rate in treated samples (ki) to the control samples (k0) after 0.5–24 hours of cultivation HELF with F1 in 0.3 mg/mL concentration (flow cytometry). *p 0.01, nonparametric Mann–Whitney U test. (C) 8-oxodG level after cultivation HELF with 0.3 mg/mL fullerene derivative F1 - dynamic change of average fluorescence intensity of 8-oxodG after 0.5–24 h (mean value for three independent experiments). *p 0.01, nonparametric U test. (D) NADPH oxidase 4 (NOX4) level after cultivation HELF with 0.3 mg/mL fullerene derivative F1 - dynamic change of average fluorescence intensity of NOX4 after 0.5–24 h (mean value for three independent experiments). *p 0.01, non-parametric Mann-Whitney U-tests.

The damaging effect of F1 on the cell can be realized in the form of oxidative modifications and breaks in the DNA of cell nuclei. When studying the level of oxidative damage to the DNA of fibroblast nuclei under the action of the F1 compound at a concentration of 0.3 mg/mL, it was found that after 0.5–1 hour the level of 8-oxodG (a marker of DNA oxidation) increases, and after 3–24 hours the level of 8-oxodG falls below the control values (Fig. 3C).

NADPH oxidases are the primary source of physiological levels of ROS in cells. One such NADPH oxidases expressed in fibroblasts is NOX4. The level of NOX4 expression in HELF, under the influence of F1 at a concentration of 0.3 mg/mL, increases significantly after 0.5–1 hour, but decreases below control values after 3–24 hours (Fig. 3D). NOX4 protein expression increase is consistent with an increase of ROS level in cells under the action of compound F1.

The formation of DNA breaks is associated with the synthesis of reactive oxygen species (ROS) in the cell and with an increase in the level of oxidative damage. The study of the number of DNA breaks in HELF was carried out using the comet method according to a standard protocol. The indicator was determined—the percentage of DNA in the tail of the comet. An hour after the addition of compound A1 at a concentration of 0.3 mg/mL to the HELF culture medium, the number of breaks in cells determined by the comet method does not increase compared to the control (Fig. 4).

Fig. 4.

Cumulative histograms for % DNA in comet’s tail and double strand break (DSB) in cells exposed to fullerene derivative F1. (A) Cumulative histograms for % DNA in comet’s tail 1h after cultivation cells with fullerene derivative F1 (0.3 mg/mL). (B) Flow cytometry detection of DSB in cells exposed to fullerene derivative F1 (1 h; 0.3 mg/mL), cells were processed for immunofluorescence staining with anti $\gamma$H2AX antibody-DyLight488 (FL1), on the histogram – median signal intensity of FL1 (mean value for three independent experiments). *p 0.01, nonparametric Mann–Whitney U test. (C) DSB in cells exposed to fullerene derivative F1 (0.5 h and 1 h; 0.3 mg/mL; fluorescence microscopy), cells stained with anti $\gamma$H2AX antibodies and DAPI. Scale bars = 20 µm.

The H2AX protein, a histone associated with DNA packaging in chromatin, undergoes phosphorylation at the serine 139 site in the vicinity of DNA breaks. This process is mediated by the action of kinases such as ATM, ATR, and DNA-dependent protein kinase (DNA-PK). This fact forms the basis for a method of detecting double-stranded breaks in DNA. The presence of phosphorylated H2AX histones, which are associated with labelled antibodies, can be visualized within the cell nucleus. Their accumulation serves as an indicator of the initiation of apoptosis in a cellular population.

Fig. 4C shows a photograph of fixed cells stained with conjugated antibodies to yH2AX labelled with FITC. The analysis showed a slight increase in the number of cells containing tags 30 minutes after the addition of F1 compounds at a concentration of 0.3 mg/mL to the HELF culture medium. After 1 hour, the number of labels in the cells after the introduction of compound F1 decreased below the control values.

By the method of flow cytofluorimetry (when comparing the medians of distributions), the data obtained by analyzing gamma foci (Fig. 4B) were confirmed. After 0.5 hours, the number of gamma-foci increases, and after 1 hour it falls below the control (Fig. 4B).

Thus, the F1 compound at a concentration of 0.3 mg/mL causes oxidative DNA damage in cells and a slight increase in the number of double-stranded DNA breaks in HELF nuclei during the “early” response period (0.5–1 hour), which is associated with increased expression of the NOX4 gene. At the same time, a rapid (within 1 hour) occurs reduction of the number of DNA breaks and (within 3 hours) the level of oxidative DNA modifications for 8-oxyguanosine below the control values.

The redox status of a cell is determined by the balance between the production of reactive oxygen species and their removal through various antioxidant defense mechanisms [24]. When the cell’s antioxidant systems are activated, the level of oxidative damage may decrease. NRF2 is one of key transcription factors regulating the level of antioxidant reaction in cells. NRF2 is the most significant regulator of cellular defenses against xenobiotic and oxidative stress. It controls the basal and induced expression of many genes of the element-dependent antioxidant response, as well as enzymes that are involved in the first and second phases of exogenous and endogenous substances detoxification [27, 28]. In response to various activating stimuli, NRF2 is stabilizing and translocates to the nucleus, where it activates the transcription of its downstream targets [29].

Under the action of fullerene derivative F1 at a concentration of 0.3 mg/mL, we found an increase in the expression level of the NRF2 (NFE2L2) gene after 1–24 hours. The increase in the expression of the NRF2 gene was significant (3.4 times) 24 hours after the addition of fullerene derivative F1 at a concentration of 0.3 mg/mL to the cell culture medium (Fig. 5A), which indicates a long-term antioxidant response of cells.

Fig. 5.

Gene expression and median flow cytometry signal intensities of cells stained with antibodies. (A) NF-E2-related factor 2 NRF2 gene expression (RT-PCR) and median flow cytometry signal intensities of cells stained with anti-NRF2-FITC antibodies, in both intact cells and cells incubated with F1 (0.3 mg/mL); mRNA levels were calculated as an average of three measurements, compared to control values. TBP was used as a reference gene. *p 0.01, nonparametric U test. (B) Breast Cancer Gene Type 1 (BRCA1) and BRCA2 expression (RT-PCR) in control cells (green line) and cells after incubation with F1 (0.3 mg/mL); mRNA levels were calculated as an average of three measurements and comparing them to control values. TBP was used as a reference gene. *p 0.01, nonparametric U test. (C) BCL2 and BAX genes expression (RT-PCR) in control cells (green line) and cells after the incubation with F1 (0.3 mg/mL); mRNA levels were calculated as an average of three measurements and comparing them to control values. TBP was used as a reference gene. *p 0.01, nonparametric U test. (D) CCND1 expression (RT-PCR) in control cells (green line) and cells after the incubation with F1 (0.3 mg/mL); mRNA levels were calculated as an average of three measurements and comparing them to control values. TBP was used as a reference gene. *p 0.01, nonparametric U test. (E) PCNA gene expression (RT-PCR) and median flow cytometry signal intensities in cells stained with anti-PCNA-FITC antibodies after incubation with F1 (0.3 mg/mL); mRNA levels were calculated as the average of three measurements compared to control values. TBP was used as a reference gene. *p 0.01, nonparametric U test.

The primary mechanism governing the activity of Nrf2 involves its interaction with the Keap1 protein. Under normoxic conditions, Keap1 binds to Nrf2, targeting it for degradation by the proteasome, while Keap1 is regenerated. However, during oxidative stress, this interaction between Nrf2 and Keap1 becomes disrupted, allowing Nrf2 to activate the transcription of genes involved in protective mechanisms [30]. An increase in the level of NRF2 protein in HELF after 0.5 hours is most likely associated with the release of NRF2 from the complex with an inhibitor, and an increase in the expression of NRF2 protein after 3–24 hours is most likely associated with an increase in the transcriptional activity of the NRF2 gene (Fig. 5A).

The BRCA1 and BRCA2 genes are activated during DNA repair in cells. The expression level of the BRCA1 gene increases after the addition of fullerene derivative F1 at a concentration of 0.3 mg/mL to the cell culture medium after 0.5 and 1 hour by 1.9 and 2.7 times, respectively (Fig. 5B). The expression level of the BRCA2 gene increases after the addition of fullerene derivative F1 at a concentration of 0.3 mg/mL to the cell culture medium after 3 to 24 hours by a factor of 1.7–1.9 (Fig. 5B).

DNA repair genes are activated within the first 30 minutes after the addition of fullerene derivative F1 to the cells. This leads to a very rapid (within 1 hour) reduction in the number of DNA breaks caused by this compound. After 3–24 hours, the F1 activates the antioxidant reaction of cells. In turn, this fact explains the low toxicity of the compound, despite the activation of ROS synthesis.

An increase in the proliferative activity of HELF in the presence of F1 at a concentration of 0.3 mg/mL was shown 24 hours after the addition of F1 (the number of cells increased by 20%) when analyzing the DNA content in cells.

We investigated the effect of F1 on the expression level of pro- and anti-apoptotic genes. It was shown that the expression level of the BCL2 gene increases significantly within 0.5–24 hours after the addition of F1 at a concentration of 0.3 mg/mL to the cell culture medium (Fig. 5A), the expression level of the anti-apoptotic BAX gene does not change (Fig. 5C), which indicates the inhibition of apoptosis by the F1 in HELF. 0.5–3 hours after the addition of F1 at a concentration of 0.3 mg/mL to the HELF culture medium, the expression level of p53 does not change, and after 24 hours it decreases by 15%. The data obtained confirm that the F1 compound does not initiate an apoptosis program in cells.

When the cell cycle begins, the production of the cyclin D1 protein is stimulated. This protein is encoded by the CCND1 gene. An increase in the level of expression of two genes, CDKN1A and CDKN2A, which are involved in the cell cycle, can lead to cell cycle arrest.

When exposed to F1 at a concentration of 0.3 mg/mL on HELF, the expression level of the CCND1 gene increases within 0.5–24 hours (Fig. 5D) at the same time, the expression level of CDKN1A and CDKN2A genes did not change, which indicates the progression of the cell cycle and an increase in the process of cell proliferation.

The increase in the proliferative activity of HELF is also indicated by an increase in the expression level of the PCNA proliferation marker after 3–24 hours in the presence of the F1 at a concentration of 0.3 mg/mL (Fig. 5E). An increase in the level of PCNA expression in HELF after the addition of compound F1 to the cell culture medium also indicates an increase in reparative synthesis in cells with the participation of delta polymerase, whose transcription factor is PCNA.

An increase in the number of cells during their cultivation in the presence of fullerene derivative F1 is associated both with the activation of the cell division process and with the inhibition of the apoptosis process. An increase in the proliferative activity of cells in the presence of F1, and activation of antioxidant systems make F1 attractive for use as a prolonged-acting antioxidant. Short-term oxidative stress, which is probably necessary to activate the antioxidant protection of cells, leaves room for doubt. This period (up to 1 hour) after exposure to F1, when the level of oxidative stress increases, the level of oxidative damage and DNA breaks increases, making the cell vulnerable to mutation formation, although activation of the repair system during this period reduces this probability to a minimum. We decided to investigate the effect of F1 on the formation of ruptures caused by small doses of radiation.

During radiation exposure of cells, the genomic integrity and stability are compromised due to the generation of single-stranded and double-stranded breaks in DNA induced by reactive oxygen species, commonly known as ROS. The study of the number of single- and double-strand DNA breaks in HELF was carried out using the comet method according to a standard protocol for determining the number of DNA breaks in cells under the action of radiation against the background of potential radioprotectors. When ionizing radiation with a dose of 1 Gr was applied to HELF, the number of DNA breaks in cells increased by 3 times. An hour after the addition of F1 at a concentration of 0.3 mg/mL to the cell culture medium, the number of double-strand breaks in cells determined by the comet method did not change compared to the control (Fig. 6A). Fullerene itself does not cause the formation of DNA breaks. The addition of this compound both before and after the action of radiation at a dose of 1 Gr slightly reduced the number of DNA breaks (Fig. 6A). At the same time, F1 stabilized the structure of HELF cores (Fig. 6B).

Fig. 6.

Cumulative histograms for % DNA in comet’s tail different degrees of damage to nuclei in cells. (A) Cumulative histograms for % DNA in comet’s tail 1h after irradiation of cells and irradiation of cells with fullerene derivative F1 (0.3 mg/mL). The differences were analyzed using Kolmogorov-Smirnov statistics (p 0.01). (B) Different degrees of damage to nuclei in cells 1 hour after irradiation of cells and irradiation of cells with the addition of F1 (0.3 mg/mL, fluorescence microscopy 100$\times$). Scale bars = 10 µm.

Thus, using the comet method, it was shown that F1 has a stabilizing effect on cell nuclei, while slightly reducing the number of DNA breaks in cell nuclei caused by radiation.