† These authors contributed equally.
Introduction: Hyperglycemic conditions achieved during pregnancy have
been shown to have detrimental effects to fetal development and increase the
prevalence of childhood comorbidities. However, the mechanisms in which diabetic
pregnancies affect placental development and subsequently contribute to adverse
health effects on the mother and offspring remain unclear. Research
design and methods: Streptozotocin was used to induce gestational diabetes in
mice. In this model, hyperglycemia was established at embryonic day 3.5 (E3.5).
Pregnancy mass was collected at E10.5, E12.5, E14.5, and E16.5 for different
assessments. Results: Both placental and embryonic weights were found to
be significantly elevated at E16.5. At E14.5, a significantly larger junctional
zone with increased number of glycogen trophoblasts was found in the placentas
from hyperglycemic pregnancies (HG group) compared to the placentas from
normoglycemic pregnancies (NG group). Importantly, the HG placenta exhibited
decreased trophoblast giant cell (TGC) association and TUNEL+ cells, and
increased expression of
Diabetes during pregnancy is known to affect the health of both mothers and their infants. Among the two types of diabetes during pregnancy, gestational diabetes (GDM) accounts for 90% and pre-gestational diabetes (PGDM) comprises the remaining 10% [1, 2]. In the United States, the GDM prevalence among pregnant women is as high as 9.2% [3]. With the introduction of insulin, diabetic-associated fetal mortality rates are reduced from 70% to nearly 12%. Unfortunately, the present birth defect rate in diabetic pregnancies (~10%) is still higher than that of the general population (3%), and appears to be ever increasing [2, 3, 4, 5, 6]. It has been suggested that placental damages from diabetic pregnancies could be the cause of fetal complications observed in the human population [7].
For a successful and healthy pregnancy, proper spiral artery (SpA) remodeling and labyrinth (LZ) angiogenesis are crucial for the establishment of adequate blood supply. Maternal blood is delivered to the placenta through the maternal SpAs, which reside in the endometrium of the uterus. During early stages of pregnancy, SpAs are classified as high resistance vessels and are surrounded by vascular smooth muscle cells (VSMCs). In order to provide adequate blood to the developing fetus, the maternal SpAs will undergo an invasive remodeling process, in which the VSMCs, possessing contractile properties, are replaced with invasive trophoblast cells [8], resulting in dilated and low resistance arteries [9]. As the intermediate barrier between fetal and maternal circulations, the placenta contains a highly developed blood network in the LZ layer. Different transporters are localized on the interhemal membrane (IHM), which separates the maternal and fetal blood. These establish a vascular network that will allow for the efficient exchange of nutrients and waste [8, 10, 11].
There is emerging evidence showing that placental malformation is a complication of diabetic pregnancies [12]. Hyperglycemic placentas are characterized by villous immaturity and edema, syncytial nodes, fibrin thrombus, and fibrinoid necrosis [7]. In addition, placentas from diabetic pregnancies have been reported to undergo “pre-mature aging”, which is detected by early emergence of placental lobe calcifications [7]. All these problems disrupt placental vasculature and result in inefficient exchange of nutrients and waste [13]. Therefore, it has been speculated that transport efficiency can be impacted by a diabetic pregnancy. Additionally, shallow remodeling of spiral arteries have been observed under gestational diabetic and preeclamptic conditions [14, 15]. Despite the known pathological changes in hyperglycemic placentas, details of how this condition affects the process of SpA remodeling and angiogenesis remain unclear.
To gain a detailed insight into the pathology and underlying mechanisms of the placenta under hyperglycemic conditions, a streptozotocin (STZ)-induced hyperglycemic mouse model of pregnancy was employed. The pathological changes of the placenta due to hyperglycemia were evaluated, followed by experiments to investigate the underlying cellular and molecular mechanisms. Additionally, the incidences of several congenital birth defects, caused by the diabetic pregnancy, were also reported.
STZ (Cat#: S0130) was purchased from Sigma (Oakville, Ontario, Canada).
Anti-
Wildtype (WT), C57BL/6J female mice, between the ages of 8–11 weeks, were maintained with a chow diet (9% fat) and water ad libitum under a 12 h light/dark cycle throughout the experiment. Prior to treatment, mice body weights, basal blood glucose levels and age were recorded. The mice were then randomly selected and administered STZ, prepared in citrate buffer (pH 7.4), at a dose of 100 mg/kg body weight (HG), or citrate buffer only (NG) on day 1 and day 4, intraperitoneally (Fig. 1A). After the second injection, the female mice were mated with male mice (C57BL/6J) overnight, and the following day at noon was considered as embryonic day 0.5 (E0.5). Random blood glucoses were measured daily after the first injection to identify the initial onset of diabetic conditions. Maternal blood glucose levels higher than 200 mg/dL were defined as a hyperglycemic pregnancy. Embryos and placentas were collected at E10.5, E12.5, E14.5 and E16.5.
STZ induced GDM results in larger placental and embryonic weight
in later stages of pregnancy. (A) STZ treatment timeline. (B) Maternal age at
start of treatment (NG n = 5; HG n = 10). (C) Maternal body weight at start of
treatment (NG n = 5; HG n = 10). (D) Basal blood glucose at start of STZ
treatment (NG n = 5; HG n = 10). (E) Maternal glucose level changes over time (NG
n = 5; HG n = 10). (F) Litter size of samples collected at E14.5 (NG n = 5; HG n
= 10). (G) Placenta weight changes over time (NG n = 5; HG n = 10). (H) Embryo
weight changes over time (NG n = 5; HG n = 10). Data are presented as Mean
All mouse experiments were completed according to a protocol reviewed and approved by the Institutional Animal Care and Use Committee of Texas A&M University, in compliance with the USA Public Health Service Policy on Humane Care and Use of Laboratory Animals.
Placentas were sagittally bisected. Half of the placenta was stored at –80
SpA remodeling during murine pregnancy involves the replacement of VSMCs by SpA-TGCs to form high circulation, low resistance blood vessels. A well-remodeled SpA is surrounded by SpA-TGCs, with a dilated lumen to support an increased blood volume during pregnancy. The remodeling process was assessed by the level of TGCs associated with the SpAs at E14.5. Based on the percentage of the arterial wall surrounded by TGCs (Cytokeratin 18 (Cytok) positive), all observed SpAs were categorized as either unremodeled (0–25%), partially remodeled (25–75%), or remodeled (75–100%). Based on the ratio of the remodeled SpAs of each placenta, placentas were further classified as “TGC-associated” if more than 50% of the spiral arteries were remodeled or “TGC-unassociated” if less than 50% of the spiral arteries were remodeled. In addition, the lumen diameter (LD) to outer diameter (OD) ratio of the SpA was measured to determine the lumen size of the SpA.
RT-PCR was performed to measure the mRNA expression of TGC migration markers.
The LZ angiogenesis was assessed by measuring the area of the maternal lacunae
space, traced by Cytok expression, and the fetal blood space, labeled by CD31
positive staining, at both E14.5 and E16.5. Images of the LZ from CD31 and Cytok
co-IF staining were captured with a Leica confocal microscope. In each sample,
outlines of fetal capillary and maternal lacune areas in 10,000
The total protein from the placentas was extracted using Cell Lysis buffer (Cell
Signaling Technology, Cat#: 9803). The concentrations were measured using the
Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Cat#:
23225). 15–30
The total RNA of mouse placentas was extracted using Trizol and RNA spin columns. cDNA was then synthesized using the SuperScript III Reverse Transcriptase kit (Thermo Fisher, Waltham, MA, Cat#: 18080051). RT-PCR was performed using a SYBR Green PCR master mix (Bio-Rad). Results were analyzed using the comparative C (T) method. The primers are listed in Table 1.
Acta2 | GGCATCCACGAAACCACCTA | TTGCGTTCTGGAGGGGCAA |
Mmp9 | AGTTCTCTGGTGTGCCCTGG | GCAGGAGGTCGTAGGTCACG |
Mmp14 | CCCAAGGCAGCAACTTCAGC | GAGTGACTGGGGTGAGCGTT |
Tgfb | TCGCTTTGTACAACAGCACC | ACTGCTTCCCGAATGTCTGA |
Embryos and placentas from at least 5 female mice per group were analyzed in this study. Data was analyzed by the student’s t-test, Chi-square test, or one-way ANOVA. Results were considered significant when the p values were less than 0.05. All statistical analyses were carried out using GraphPad Prism.
Before pregnancy, female mice demonstrated synonymous age and body weight (Fig. 1B,C). The blood glucose of the HG and NG groups were normal (Fig. 1D). Daily
random blood glucose checks identified a significant increase of blood glucose
levels in the HG group beginning at E2.5. At E3.5, 80% (8 out of 10) of the HG
mice reached a hyperglycemic condition (
Increased placental weights were observed in the HG group beginning at E12.5 and reached significance at E16.5 (Fig. 1G). The HG group also showed a significantly larger embryonic weight at E14.5 and E16.5 (Fig. 1H). The placental efficiency of the HG placentas was lower at E12.5, but this observation was reversed at E16.5 (Supplementary Fig. 1).
The effect of GDM on placenta morphology was assessed at E14.5. An increased thickness in the junctional zone (JZ) was observed in the HG placentas (Fig. 2A, white arrow). Additionally, the HG placenta displayed a larger portion of the whole placenta to be occupied by the JZ and the LZ to take up a smaller portion, when compared to the NG placenta (Fig. 2B). This resulted in a significantly smaller LZ to JZ area ratio in HG placentas (Fig. 2C). PAS staining was performed to specifically label the glycogen trophoblast cells (GlyTs), which are enriched with glycogen (Fig. 2D). Thus, the PAS negative cell population was majorly composed of spongiotrophoblast cells (SpTs). The PAS staining showed no difference in the SpT area ratios in the JZ area of the HG and NG groups. However, a larger ratio of GlyT area was noticed in the HG group (Fig. 2F). In addition, the total area of the venous sinus was significantly decreased in the JZ of the HG group (Fig. 2G). Tpbpɑ staining (Fig. 2H) showed that the number of SpTs is not changed, while the GlyT cell count increased significantly (Fig. 2J,K). Western blots performed on the whole placenta showed that hyperglycemia enhanced the level of Tpbpɑ (Fig. 2I), a protein highly expressed in GlyT, which is consistent with the increased total area of GlyTs.
E14.5 GDM placentas have larger JZ areas with increased GlyTs.
(A) JZ visibly occupies a larger area of the placenta. Slide image from PAS
staining. (B) JZ and LZ area proportion within the placenta (NG n = 8; HG n = 9).
(C) LZ to JZ ratio (NG n = 8; HG n = 9). (D) PAS staining of GlyTs within the JZ
and IF staining of Tpbp
The decidua (DZ) layer was found to have fewer TGCs, marked by Cytok expression (Cytok+), surrounding the SpAs (CD31+) in the HG placentas (Fig. 3A). When all TGC associations to SpAs were evaluated together, the HG placenta presented more unremodeled SpAs, and less partially and fully remodeled SpAs (Fig. 3B). As shown in Table 2, 9 out of the 10 NG placentas were graded as “TGC-associated”, while the HG group only had 3 out of 9 TGC-associated placentas. The placentas from the HG group also had a significantly smaller LD/OD ratio (Fig. 3C,D). The SpA remodeling level was further evaluated by the expression of ɑ-SMA, a marker of VSMCs that surround the SpA. The HG placenta showed a higher ɑ-SMA expression on the SpA (Fig. 3E), and less apoptotic cells surrounding the SpAs (Fig. 3F), suggesting hindered remodeling. Consistently, the mRNA expression level of Acta2, which is an alias for ɑ-SMA [17], was found to be significantly higher in the HG placentas at E12.5 (Fig. 3G), suggesting an increased presence of VSMCs, hence decreased remodeling by TGCs.
GDM hinders SpA remodeling evidenced by decreased TGC
association, VSMC breakdown, and mRNA expression of migratory genes. (A) Co-IF
of CD31, Cytok, and DAPI. SpAs and TGCs are visualized by CD31 and Cytok,
respectively. (B) Ratio of classification of TGC association by sample (NG n = 9;
HG n = 10). (C) Vascular wall structure visualized by H&E staining. (D) LD to OD
ratio indicating degree of vascular remodeling (NG n = 10; HG n = 10). (E) SpA
VSMC visualized by ɑ-SMA IHC. (F) TUNEL staining on SpA. SpA indicated by the
black arrow. #TUNEL+ cell around the SpA (NG n = 5; HG n = 5). (G) mRNA level of
genes involved in TGC migration and SpA vascular wall composition at E12.5 (NG n
= 4; HG n = 4). Data are presented as Mean
Total | Associated | Unassociated | |
NG | 10 | 9 | 1 |
HG | 9 | 3 | 6 |
p-value* | 0.02 | ||
* The p-value was calculated via |
The reduced number of SpA-TGCs and discrepancies observed in the SpA wall
suggested a migration problem of the TGCs. Thus, the influence of GDM on the
expression of genes involved in TGC migration was then examined. Mmp2, Mmp9 and
Mmp14 are pro-migratory proteins, while Tgf
The HG group had a decreased trend of fetal blood space and the maternal lacunae area at both E14.5 and E16.5, however neither showed statistical significance (Fig. 4A–C). The mean of the maternal lacunae and fetal capillary space also did not show any differences between the HG and NG groups (Fig. 4D). The HG placentas were found to display a thicker IHM compared to the NG placentas at E16.5 (Fig. 4E).
GDM increases IHM thickness. (A) Co-IF of CD31, Cytok, and
DAPI. Zoomed in example shows the IHM (white bar), MLA (yellow line) and FCA
(cyan line) that was measured for (B) (C) (E). (B) FCA defined by area enclosed
by CD31 (NG n = 7; HG n = 7). (C) MLA defined by area encircled by Cytok and not
occupied by fetal capillary or DAPI (NG n = 7; HG n = 7). (D) Mean of FCA and MLA
(NG n = 7; HG n = 7). (E) IHM thickness (NG n = 7; HG n = 7). Data are presented
as Mean
To gain an insight of how hyperglycemia impacts embryonic development, embryos
were harvested at E14.5. The number of congenital defects, including the neural
tube defects (NTD), ocular defects, craniofacial defects, and heart defects, were
counted (Fig. 5A,B). 11 out of 73 of the HG embryos displayed at least one type
of the evaluated birth defects, while no birth defects were observed in the NG
group (Table 3, p
GDM increases the incidence of hyperplastic ventricular disease
and congenital malformations. IHM thickness is increased in placentas from
malformed embryos. (A) Normal embryo at E14.5. (B) Observed congenital
malformations include NTD, ocular defect, craniofacial defect, and edema. (C)
H&E staining of E14.5 embryonic hearts labeled with LV, RV, and IVS. (D) Heart
weight (NG n = 7; HG n = 7). (E) IVS thickness (NG n = 4; HG n = 4). (F)
Myocardium tissue area that occupies the left and right ventricle individually
(NG n = 10; HG n = 10). (G) p-H3S10 IF staining of heart sections at E12.5. (H)
p-H3S10 positive cell percentage at E12.5 (NG n = 4; HG n = 4). (I) mRNA level of
genes involved in cell cycle and proliferation at E12.5 (NG n = 4; HG n = 4). (J)
IHM thickness in placenta from normal embryos and embryos with congenital defects
(NG n = 5; HG n = 3). (K) GlyT/SpT ratio in placenta from normal embryos and
embryos with congenital defects (NG n = 5; HG n = 3). (L) SpA LD/OD ratio in
placenta from normal and congenital defect embryos (NG n = 5; HG n = 3). Data are
presented as Mean
Total | Normal | Total congenital defect | NTD | Ocular defect | Craniofacial defect | |
NG | 81 | 81 | 0 | 0 | 0 | 0 |
HG | 73 | 62 | 11 | 7 | 3 | 1 |
p-value* | p |
p |
0.104 | 0.474 | ||
* The p-values were calculated via the Fisher-Exact tests. |
Total | ASD | VSD | DORV | OA | |
NG | 7 | 0 | 0 | 0 | 0 |
HG | 17 | 0 | 0 | 1 | 0 |
To understand if the congenital birth defects were associated with any abnormal feature of the placenta, placental samples with congenital defects, regardless of them being in the NG or HG group, were pooled in a “Congenital Defect” group, while the rest were grouped as “Normal”. One-way ANOVA was performed on the data of GlyT/SpT ratio, the LD/OD ratio and the IHM thickness. A Chi-square test was performed on the TGC-SpA association data in terms of congenital defect group versus the normal group. The results showed a marginal significance of IHM thickness and the congenital defects (p = 0.085), but not for the GlyT/SpT ratio (p = 0.200), the LD/OD ratio (p = 0.207) and the TGC-SpA association (p = 0.222) (Fig. 5J–L).
In this study, the pathological changes of the placenta and its association with birth defects caused by hyperglycemia was investigated using a diabetic pregnant mouse model. Compared to other mouse studies that generated hyperglycemia before mating [21, 22, 23], this study utilized a mouse model with hyperglycemia established at E3.5. Pre-pregnancy diabetes has been known to affect ovulation and implantation [5]. Therefore, this model avoids placental abnormalities associated with pregnancy establishment. Embryos and placentas from hyperglycemic pregnancies were reported to have altered growth metrics. Additionally, placentas under hyperglycemic conditions were found to have a proportionately larger JZ, mainly due to an increased number of GlyTs. Most important, the hyperglycemic placentas displayed defects in SpA remodeling and IHM thickness. Interestingly, IHM thickness appeared to be associated with a higher incidence of birth defects in the embryos.
This study provides in vivo evidence of hyperglycemia disrupting SpA
remodeling. This is indicated by decreased TGC association and higher remnants of
LZ layer angiogenesis is critical for establishing proper blood supply to support a healthy pregnancy. Phenotypic analyses revealed that the IHM was thicker in the hyperglycemic group, consistent with observed thickening of the basement membrane in human GDM placentas [7, 33]. The cause of the thickened IHM is still unclear. One potential mechanism of this phenomenon is an extracellular matrix buildup due to an altered microenvironment accompanying inflammation [34]. It is also possible that premature trophoblasts observed in GDM placentas may alter the thickness of their cell membranes, which further affects the IHM [35, 36]. Additionally, human GDM placentas often show hypervascularization and villous immaturity [37]. However, these phenotypes were not observed in this murine study. A previous review suggested that GDM affects placental angiogenesis in later stages of pregnancy [38]. Therefore, future studies using later stages of placental development, e.g., E16.5 or E18.5, may elucidate the mechanisms behind hyperglycemic induced temporal dysregulation of placental angiogenesis.
It is suggested that the JZ is the most sensitive placental compartment to diabetic conditions [39, 40, 41, 42]. Consistent with previous reports [40], hyperglycemic conditions caused the relative size of the JZ to increase in this study. The Tpbpɑ IF staining showed that the larger JZ area was mainly due to increased GlyTs and not SpTs. It has previously been reported that hyperglycemia enhances expression of genes involved in JZ development, such as Taf7I, Pappa2, and Plac1 in the rat placenta [24]. Together, this data, along with other reports, suggest that hyperglycemia impacts the JZ development, particularly the cell population of this layer.
The mouse hyperglycemic pregnancies displayed an increased embryonic weight over time. Human GDM pregnancies are often complicated by macrosomia due to accelerated fetal growth in the later pregnancy [43]. In this GDM mouse model, a similar phenotype was observed, in which embryonic weight began to increase at E14.5 and was significantly higher at E16.5. Among the embryos that were collected at E14.5, the rate of congenital malformations, especially the NTDs, was increased in hyperglycemic pregnancies, which is a consistent finding in fetuses of diabetic pregnancies [44, 45]. In this study, congenital heart defects were not associated with diabetic pregnancies, which seems to be inconsistent with previous reports in humans [46]. This could be due to a small sample size not producing enough power for this association study, since the incidence rate of congenital heart defects in diabetic pregnancy was around 3% [47, 48]. However, hyperplastic ventricles due to increased cell proliferation, with a thickened IVS were observed in our hyperglycemic pregnant mouse model, which was consistent with other reports [45, 49]. It has been suggested that placental damages from GDM could be the cause of fetal complications observed in the human population [7]. Moreover, for the first time, this study demonstrated an association between IHM thickness and birth defects, although the same was not observed with GlyT/JZ nor LD/OD. The IHM is where exchange of gas and nutrients occur via diffusion, transporters, and endocytosis/exocytosis [50]. Theoretically, the transport of nutrients, such as sugars, amino acids, and fatty acids, will be affected when its travel distance across the maternal and fetal interface is relatively longer, as the IHM remains thicker under hyperglycemia. This altered availability, either in rate or amount, of these macro-nutrients during development could have an impact on crucial developmental milestones. Further research is needed to confirm this hypothesis.
In summary, we demonstrated that hyperglycemia disrupted SpA remodeling possibly via interference of SpA-TGCs migration. Placentas from hyperglycemic pregnancies had thickened IHM, which was associated with increased birth defects. This study provides insights into the placental changes that occur under hyperglycemic pregnancies in vivo. These observed morphological and molecular changes should be further explored to identify more focused targets affected by hyperglycemia to establish strategies to mitigate congenital malformations and pregnancy complications associated with GDM.
LX conceived the idea and designed the study; YQ, NM, ZD and ZL performed the experiments; KZ, YQ, NM, ZD and LL analyzed the data; LX, YQ, NM, ZD and LL wrote the manuscript.
All mouse experiments were completed according to a protocol (AUP#2018-0309) reviewed and approved by the Institutional Animal Care and Use Committee of Texas A&M University, in compliance with the USA Public Health Service Policy on Humane Care and Use of Laboratory Animals.
Thanks to all the peer reviewers for their opinions and suggestions.
This project was supported by grants from the National Institutes of Health (NIDDK 1R01DK112368-01 to Drs. Xie and Zhang). This work was funded, in part, by the grant from the National Institute of Environmental Health Sciences (P30 ES029067).
The authors declare no conflict of interest.
Given her role as Guest Editor in special issue: The Effects of Maternal Nutrition on Metabolism of Infants and Children, LX had no involvement in the peer-review of this article and has no access to information regarding its peer-review. Full responsibility for the editorial process for this article was delegated to GP.
GDM, gestational diabetes; PGDM, pre-gestational diabetes; STZ, streptozotocin; JZ, junctional zone; LZ, labyrinth; DZ, decidua; PAS, periodic acid–Schiff; GlyT, glycogen trophoblast; SpT, spongiotrophoblast; SpA, Spiral Artery; VSMC, vascular smooth muscle cell; TGC, trophoblast giant cell; LD, lumen diameter; OD, outer diameter; FCA, fetal capillary area; MLA, maternal lacune area; IHM, interhemal membrane; NTD, neural tube defect; IVS, interventricular septum.