† These authors contributed equally.
Migraine (Mg) is a multifaceted neurovascular disorder caused by genetic and
several environmental etiologies. We have implemented a case-control study of
TNF
Migraine (Mg) is one among the neurovascular disorder with characteristic heterogeneous clinical symptoms, which includes unilateral pulsatile headache that might last 4–72 hours, hypersensitivity such as phonophobia, photophobia, nausea and vomiting [1]. This disorder is of two distinct types based on their symptoms: (MgA), Mg with aura also called classical Mg and MO, Mg without aura common Mg also called Mg [2]. Previously, a meta-analysis was showed to evaluate the global occurrence of Mg relating 6,216,995 participants, which explained the pooled Mg occurrence of 10.4% in Africa, 11.4% in Europe, 16.4% in South and Central America, 9.7% in North America and 10.15% in Asia [3]. The essential features to be considered in Mgs can be explained as follows, the physiological basis for the aura, head pain anatomy, and genetics of Mg [4]. A genome-wide association study (GWAS) with broadly-defined headache, have documented 28 susceptible loci in the genes such as LRP1, STAT6, SDR9C7, FHL5, UFL1, TRPM8, HJURP, LINC02210-CRHR1, MAPT, MYO1H, IFT81, PTBP2, and MACF1 respectively [5].
The Tumor Necrosis Factor alpha (TNF
Previous studies documented the function of cytokines in regulating biological
processes, such as, TNF
The case-control study comprised 212 Mg patients and 218 healthy controls were enrolled from Neurology Department, Chettinad Super Speciality Hospital, Tamil Nadu, India, among January–July 2018. Migraineurs were diagnosed by an experienced neurologist (KS) based on International Classification of Headache Disorders (ICHD) (3rd Edition) strategy by International Headache Society (IHS) for Mg [13]. The controls were also from the same ethnic background (Asian) and free from disease. The clinical and demographic characteristics were recorded for each of the study participants using a questionnaire framed by the investigators. The entire study design was accepted by the Chettinad Academy of Research and Education, Institutional Human Ethics Committee (390/IHEC/10-17). Prior to the sampling permission was attained from the participants of this study. The subjects with cardiac ailments, HIV-seropositive, and other neurodegenerative disorders were excluded from this study.
Peripheral blood (4 mL) was collected from the Migraineurs and controls, the
salting-out method with some minor modifications was used to isolate the genomic
DNA [14]. Genotyping of rs1800629 polymorphism was carried out using
(Table 1) by Amplification Refractory Mutation System-Polymerase Chain Reaction
(ARMS-PCR) [15]. The PCR was performed in Applied Biosystems
Veriti® Thermal Cycler (USA) in 10
Primer-ID | Primer sequence (5′–3′) | Allele | No of base pairs | Tm ( |
Total length (Bp) |
TNF |
CAACACAGCTTTTCCCTCCAACCCCGTT | 28 | 69 | ||
400 | |||||
TNF |
TGGTGGAGAAACCCATGAGCTCATCTGG | 28 | 69 | ||
TNF |
GGAGGCAATAGGTTTTGAGGGGCAGGG | G | 28 | 69 | 251 |
TNF |
GTAGGACCCTGGAGGCTGAACCCCGTACT | A | 29 | 69 | 202 |
IF, inner forward; IR, inner reverse; OF, outer forward; OR, outer reverse. |
Pearson
Comprehensive literature was implemented in the available records such as
Cochrane Library, NCBI-PubMed, MEDLINE, EMBASE, and Google Scholar upto December
2018 that addressed the association of TNF
Studies incorporated in this meta-analysis were necessary to meet the subsequent
criteria. (i) Studies should have two groups (Case-Controls). (ii) Second,
studies should have assessed the relationship of TNF
The bibliographic search and records were mined by two investigators [PK and AN] and any contradictions were solved by a mutual conversation (RK, SSJ and AH). The information such as publication year, first author name, region of study, origin, Mg diagnostic criteria, DNA source, the sample size of Migraineurs and controls, genotype frequency and methods of genotyping has been extracted. The quality assessment was independently performed for each of the incorporated studies by HWE [17] and the Newcastle Ottawa Scale (NOS) [18].
The relationship between TNF
The geographical attribution of migraineurs and controls are summarized in Table 2. Amidst the 430 participants joined in this study, the age range in migraineurs
and controls were 37.75
Factors | Migraineurs | Controls |
(N = 212) | (N = 218) | |
Men:Women | 70:142 | 78:140 |
Mean Age | 37.75 |
35.33 |
Mg with:without aura | 45:167 | Nil |
Age of disease onset | 26.9 |
Nil |
Family history of Mg | 36 | Nil |
Pain severity | Low: 47 | Nil |
Moderate: 63 | Nil | |
Severe: 102 | ||
Location of headaches | One side: 79 | Nil |
Both Sides: 71 | ||
Entire head: 62 | ||
Data are presented as mean |
The genotype distribution of TNF
Migraineurs | Controls | |||||||||
Polymorphism | Frequencies | (%) | (%) | HWE | OR | 95% CI | p-value | |||
n = 212 | n = 218 | |||||||||
rs1800629 | Allele | |||||||||
G | 354 (83.49) | 360 (78.28) | - | Reference | ||||||
A | 70 (16.50) | 76 (17.43) | - | 0.93 | [0.65–1.33] | 0.71 | 0.394 | |||
Genotype | ||||||||||
GG | 158 (74.52) | 152 (69.72) | Reference | |||||||
GA | 38 (17.92) | 56 (25.68) | 0.11 | 0.65 | [0.40–1.04] | 3.21 | 0.073 | |||
AA | 16 (07.54) | 10 (04.58) | 2.35 | [0.96–5.74] | 3.67 | 0.045* | ||||
Genetic models | ||||||||||
Dominant | GA + AA vs GG | - | - | - | 0.58 | [0.26–1.32] | 1.66 | 0.138 | ||
Recessive | AA vs GG + GA | - | - | - | 1.27 | [0.83–1.93] | 1.23 | 0.157 | ||
HWE, Hardy Weinberg equilibrium; OR, Odd’s ratio; |
Additionally, dominant and recessive genetic models were also analyzed, which
showed insignificant associations between the Migraineurs and controls for
rs1800629 polymorphism. The DNA sequence electropherograms representing
the homozygous dominant, heterozygous and homozygous recessive genotypes of
rs1800629 polymorphism are illustrated in Fig. 1. The sequences of
TNF
DNA sequence electropherogram of rs1800629 polymorphism
in TNF
Circos plot illustrating the chromosomal interactions among the current SNP (rs1800629) and its associated SNPs.
The comprehensive literature search in the available databases using PRISMA guidelines retrieved a total of 176 publications of which 10 studies were selected for meta-analysis. All the selected studies [11, 22, 23, 24, 25, 26, 27, 28, 29, 30] were assessed for quality using on HWE and Newcastle Ottawa Scale. The main characteristics such as study name with year, ethnic origin, country, DNA isolation source, Mg diagnostic criteria, total no of study participants (Migraineurs and healthy controls), NOS Score, genotyping methods, allele and genotypic frequencies, HWE, and chi-square are summarized in Tables 4 (Ref. [11, 22, 23, 24, 25, 26, 27, 28, 29, 30]), 5 (Ref. [11, 22, 23, 24, 25, 26, 27, 28, 29, 30]). Between the selected articles, seven studies have used PCR-RFLP, whereas two studies (including our study) have adopted ARMS-PCR and the outstanding two researches used further techniques for genotyping.
Study name | Year | Country | Ethnicity | Source of DNA | Diagnostic criteria | No of cases | No of controls | NOS score | Genotyping method |
Asuni et al. [22] | 2009 | Italy | Caucasian | Blood | ICHD-II | 301 | 278 | 7 | PCR |
Ates et al. [23] | 2011 | Turkey | Asian | Blood | HIS | 203 | 202 | 6 | ARMS-PCR |
Fawzi et al. [11] | 2015 | Egypt | Egyptian | Blood | HIS | 200 | 200 | 8 | PCR-RFLP |
Ghosh et al. [24] | 2010 | North India | Asian | Blood | HIS | 216 | 216 | 7 | PCR-RFLP |
Herken et al. [25] | 2005 | Turkey | Asian | Blood | HIS | 60 | 62 | 6 | PCR-RFLP |
Lee et al. [26] | 2007 | Korea | Asian | Blood | HIS | 439 | 382 | 6 | PCR |
Pappa et al. [27] | 2010 | Greece | Caucasians | Blood | ICHD-II | 103 | 178 | 7 | PCR-RFLP |
Rainero et al. [28] | 2004 | Italy | Caucasian | Blood | HIS | 299 | 306 | 7 | PCR-RFLP |
Stuart et al. [29] | 2013 | Australia | Caucasian | Blood | HIS | 335 | 345 | 7 | HRM, RFLP |
This study | 2018 | India | Asian | Blood | HIS | 212 | 218 | 7 | ARMS-PCR |
Yilmaz et al. [30] | 2010 | Turkey | Asian | Blood | ICHD-II | 67 | 96 | 7 | PCR-RFLP |
PCR, Polymerase Chain Reaction; RFLP, Restriction Fragment Length Polymorphism; ARMS-PCR, Amplification-Refractory Mutation System Polymerase Chain Reaction; HRM, High Resolution Melting analysis; HIS, International Headache Society; ICHD-II, International Classification of Headache Disorders; NOS, Newcastle-Ottawa Scale. |
Study name | Cases | Controls | Cases | Controls | HWE | Chi-square |
(GG/GA/AA) | (GG/GA/AA) | (G/A-Allele) | (G/A-Allele) | |||
Asuni et al. [22] | 272/28/1 | 249/28/1 | 572/30 | 526/30 | 0.822 | 0.05 |
Ates et al. [23] | 125/78/0 | 162/40/0 | 328/78 | 364/40 | 0.118 | 2.43 |
Fawzi et al. [11] | 136/51/13 | 169/29/2 | 323/77 | 367/33 | 0.55 | 0.35 |
Ghosh et al. [24] | 175/41/0 | 191/24/1 | 391/41 | 406/26 | 0.793 | 0.06 |
Herken et al. [25] | 54/5/1 | 53/9/0 | 113/7 | 115/9 | 0.537 | 0.37 |
Lee et al. [26] | 377/61/1 | 338/41/3 | 815/63 | 717/47 | 0.168 | 1.89 |
Pappa et al. [27] | 89/14/0 | 145/31/2 | 192/14 | 321/35 | 0.813 | 0.05 |
Rainero et al. [28] | 256/42/1 | 207/88/11 | 554/44 | 502/110 | 0.665 | 0.18 |
Stuart et al. [29] | 220/95/20 | 230/97/18 | 535/135 | 557/133 | 0.072 | 3.21 |
This study | 158/38/16 | 152/56/10 | 354/70 | 360/76 | 0.11 | 2.52 |
Yilmaz et al. [30] | 37/23/7 | 79/16/1 | 97/37 | 174/18 | 0.851 | 0.03 |
HWE, Hardy-Weinberg equilibrium. |
The heterogeneity analysis of TNF
Forest plot representing the overall risk for SNP rs1800629.
Forest plot representing the overall risk for SNP rs1800629 under heterozygote model.
Funnel plot of publication biases on the relationships between
TNF
Genetic models | Ethnicity | Q | Q-p | I |
Model | OR 95% CI | Z-test | p-value |
Allelic model | Caucasian | 21.92 | 86 | Random | 0.70 [0.40–1.23] | 1.25 | 0.210 | |
A vs G | Asian | 20.93 | 0.0008 | 76 | Random | 1.53 [1.02–2.31] | 2.03 | 0.040* |
Homozygote model | Caucasian | 7.23 | 0.06 | 58 | Random | 0.46 [0.10–2.09] | 1.00 | 0.310 |
AA vs GG | Asian | 7.34 | 0.12 | 45 | Fixed | 1.75 [0.93–3.27] | 1.74 | 0.080 |
Heterozygote model | Caucasian | 2.89 | 0.41 | 0 | Fixed | 1.21 [0.66–2.20] | 0.62 | 0.540 |
GA vs GG | Asian | 6.49 | 0.17 | 38 | Fixed | 0.57 [0.29–1.13] | 1.61 | 0.110 |
Dominant model | Caucasian | 18.31 | 0.0004 | 84 | Random | 0.69 [0.39–1.22] | 1.26 | 0.210 |
GA + AA vs GG | Asian | 23.85 | 0.0002 | 79 | Random | 1.54 [0.95–2.50] | 1.75 | 0.080 |
Recessive model | Caucasian | 6.20 | 0.10 | 52 | Random | 0.51 [0.13–2.02] | 0.96 | 0.341 |
AA vs GA + GG | Asian | 6.52 | 0.16 | 39 | Fixed | 1.77 [0.94–3.31] | 1.78 | 0.070 |
*Significant (p value |
Mg is a multi-faceted neurovascular disorder with recurring attacks of a severe headache which are often accompanied by neurological disturbances and nausea. They have a solid genetic foundation such as disorders of Mg caused by variations in monogenic forms, as well as familial clustering in Mg which is related to polymorphisms in several genes (polygenic forms) [31]. The Global Burden of Diseases (GBD), Risk Factors and Injuries studies performed a large worldwide ethnicity-based cross-sectional survey on Mg and with the pressure-type headache from the year 1990 and 2016 using Bayesian meta-regression model. The results revealed that 3000 million individuals were approximated to have pressure-type headache/Mg in the year 2016, in which 1040 million (95% uncertainty interval [UI] 1.00–1.09) with Mg and 1089 million (95% UI 1.71–2.10) with pressure-type headache respectively. These estimates provide us the need for more focus on headache and its related disorders [32].
TNF
The meta-analysis of TNF
This meta-analysis study has some limitations that must be considered such as;
first, literatures available only in the English language were included. Second,
stratification examination based on Mg with and without aura was not performed
due to lack of equal availability of samples in both the conditions. Third, the
genotypic frequencies were not correlated with the serum TNF
To conclude, the association study of TNF
Conceived and designed the experiments: PK, APS, RSRAH, KS, SSSJA, and RV. Performed the experiments: APS, UV, RSRAH and PK. Analyzed the data: RSRAH, APS and PK. Writing, Reviewing and Editing: RSRAH, SSSJA and RV. All authors read and approved the final manuscript.
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and national research committee (Ethic code: 390/IHEC/10-17) and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.
All the authors were thankful to the patients and controls for participating in this current study. The author (AH) wishes to acknowledge Chettinad Academy of Research and Education (CARE) for providing Chettinad Research fellowship.
This research received no external funding.
The authors declare no conflict of interest.
PCR, Polymerase Chain Reaction; ARMS-PCR, Amplification-refractory mutation
system-PCR; OR, Odds ratio, CI, Confidence Interval; MA, Mg; MO, Mg without aura;
GWAS, Genome-wide association study; LRP1, LDL receptor related protein 1; STAT6,
Signal transducer and activator of transcription 6; SDR9C7, Short Chain
Dehydrogenase/Reductase Family 9C Member 7; FHL5, Four And A Half LIM Domains 5;
UFL1, UFM1-protein ligase 1; TRPM8, Transient receptor potential cation channel
subfamily M; HJURP, Holliday junction recognition protein; LINC02210-CRHR1, Long
Intergenic Non-Protein Coding RNA 2210-Corticotropin Releasing Hormone Receptor
1; MAPT, Microtubule Associated Protein Tau; MYO1H, Myosin 1H; IFT81,
Intraflagellar Transport 81; PTBP2, Polypyrimidine Tract Binding Protein 2;
MACF1, Microtubule Actin Crosslinking Factor 1; MHC, Major histocompatibility
complex; TNF, Tumor necrosis factor; TNFR1-TNFRSF1A, Tumor necrosis factor
receptor 1-Tumor necrosis factor receptor superfamily member 1A; TNFBR-TNFRSF1B,
Tumor necrosis factor receptor B- TNF receptor superfamily member 1B; IL1a,
Interleukin 1a; IL1b, Interleukin 1b; IL4, Interleukin4; IL5, Interleukin5;
TNF