† These authors contributed equally.
Objective: Study of important molecules involved in the pathogenesis of cervical cancer will be of great significance for the early screening and treatment. Growing evidence suggests that Vacuolar protein sorting (VPS) proteins play roles in cancer biology. However, the role of VPS50 in cancers have not been explored. The purpose of this study is to explore the role of VPS50 in the progression of cervical cancer. Methods: In silico analysis was performed to explore the expression and mutation of VPS50 in several cancers. A shRNA against VPS50 were constructed to knockdown VPS50 in SiHa cells, which is a cervical cancer cell line. Cell growth was detected by clone formation assay and Celigo cell counting assay. Apoptosis rate was measured by flow cytometry and Caspase-3/7 Assay. PathScan intracellular signaling arrays kit was used to detect the changes of signaling molecules involved in Stress and Apoptosis pathway after VPS50 knockdown in SiHa cells. Results: VPS50 is highly expressed in various cancers including cervical cancer, and various VPS50 mutations exist in cancer cells. Down-regulation of VPS50 expression results in decreased cell proliferation and an inhibition of colony formation of SiHa cells. Moreover, VPS50 knockdown could significantly induce the apoptosis of SiHa cells by activating the Stress and Apoptosis Pathway. Discussion: Our study has demonstrated that VPS50 plays an essential role in the progression of cervical cancer and may serve as a potential therapeutic target for cervical cancer.
Cervical cancer (CC) is one of the most common gynecologic tumors and is responsible for more than 300,000 deaths worldwide each year [1,2]. In developed countries, early detection through screening has led to a substantial decline in mortality from CC. However, mortality remains high in developing countries and in low-income families [2,3]. Most patients diagnosed with CC receive radiotherapy or chemotherapy, resulting in a heavy financial burden [2,4]. Furthermore, the clinical outcome varies greatly and some patients diagnosed with early stage disease later develop tumor metastasis resulting in shortened survival [5]. The molecular mechanisms that underlie the progression of CC remain unclear, thus hindering the development of more effective treatments. Hence, the identification of important pathways and molecules involved in the pathogenesis of CC will be of great significance for early detection through screening and for improved treatment.
Cancer cells are able to carry out relatively minor modifications to normal physiological processes, which can in turn result in markedly altered phenotypes. Endocytosis has been identified as one such physiological process that undergoes modification during carcinogenesis [6,7]. Many cancer cell types lose the ability to regulate the function of important growth control receptors such as epidermal growth factor receptor (EGFR) and ErbB family of receptor tyrosine kinases (RTK). These key regulators of growth cannot be internalized, recycled or degraded by the cancer cell, thereby accelerating tumor development [6-8]. The process of unregulated receptor endocytosis provides a range of potential targets for the treatment of cancer. In theory, the removal or inhibition of oncogenic proteins that are defective for endocytosis might inhibit cancer progression. Significant advances have recently been made in understanding the molecular changes that occur to the endocytic pathway during cancer progression [7,8]. A multi-subunit tethering complex called endosomal-associated recovery protein (EARP) is involved in endocytosis. This complex consists of four vacuolar protein sorting-associated (VPS) proteins that are referred to as VPS50, VPS51, VPS52 and VPS53. There is growing evidence to suggest that VPS proteins play important roles in tumor biology. VPS52 can induce apoptosis in gastric cancer and suppress the growth of this cancer type [9]. VPS53 may have multiple roles in a variety of human tumor types. For example, in human CC it can act as a tumor suppressor by regulating the apoptosis pathway [10,11]. VPS50, also known as CCDC132 or Syndetin, is another component of EARP. To date, a role for VPS50 in tumors has yet to be reported [8]. In the present study we found that VPS50 is highly expressed in various cancer types, including human CC. Knockdown of VPS50 expression inhibited the proliferation of CC cells, enhanced their apoptosis and prevented colony formation. Furthermore, molecules involved in the Stress and Apoptosis-related signaling pathway were significantly up regulated according to the Path Scan intracellular signaling array. Therefore, these results suggest that VPS50 is required for the growth of CC cells.
The SiHa human CC cell line was purchased from the Chinese Academy of Sciences
(Shanghai, China) and grown in ATCC-formulated Eagle’s Minimum Essential Medium
(Catalog No. 30-2003) containing 10% fetal bovine serum (GIBCO, Scoresby,
Australia) and 100 U/mL penicillin/streptomycin (GIBCO, Carlsbad, CA, USA) at 37
The cBioPortal database (http://www.cbioportal.org/) was used to extract expression and mutation datasets for VPS50 in various cancer cell lineages including adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, CC, glioblastoma, lung adenocarcinoma, ovarian serous cystadenocarcinoma and stomach adenocarcinoma
Total RNA was prepared using the RNeasy Mini kit (QIAGEN, Hilden, Germany) as described by the manufacturer. It was then reverse-transcribed using the SuperScript II First-Strand Synthesis System (Invitrogen). qPCR analyses were performed using SYBR green detection (ABI, Auckland, New Zealand) and the following primers (GeneChem Co., Shanghai, China): VPS50 forward, 5’CATCTGGGGATACGCTGTATG3’ and reverse, 5’GTAGTTCACTGGCGGTTGA G3’. GAPDH forward, 5’TGACTTCAACAGCGACACCCA3’ and reverse, 5’CACCCTGTTGCTGTAGCCAAA3’.
Western blotting was performed as described previously [12]. Briefly, SiHa cells
were harvested and lysed with RIPA buffer (10 mM Tris-HCL, pH 7.6, 1 mM
ethylenediamine tetra-acetate (EGTA) and 1,2,bis,2
amino-ethoxyethane-NNNN-tetra-acetic acid (EDTA), 0.1% SDS, 1% Triton X-100,
0.1% NA-Deoxycholate, 1
The colony formation assay was performed as described previously [13]. SiHa
cells were seeded into 6-well plates at 200 cells/well with 2 mL of medium and
grown at 37
Lentiviruses expressing short hairpin RNAs (shRNAs) that target the
VPS50 gene sequence (5’TCAAGAAAGCCTCAGT GAT3’) and scramble shRNA as the
control were obtained from Shanghai GeneChem Co., Ltd (Shanghai, China). The
corresponding shRNAs were cloned into a pGCSILgreen fluorescent protein
lentiviral vector to generate recombinant lentiviral shRNA expression vectors.
For the packaging of lentivirus, HEK293FT cells were co-transfected with shRNA
plasmid constructs and with packaging plasmids using Fugene HD transfection
reagent as recommended by the manufacturer. Lentivirus particles were purified by
ultracentrifugation and endpoint dilution assay was used to determine their
titer. SiHa cells seeded into 6well plates (3
SiHa cells from logarithmic growth phase were resuspended in culture medium and seeded into 96-well plates at a density of 1.000 cells/well. Starting the next day, a Celigo Image Cytometer (Nexcelom Bioscience, Lawrence, MA, USA) was used to measure at 488 nm wavelength each day for five consecutive days, thus generating cell growth curves.
The annexin V-allophycocyanin (APC) apoptosis detection kit (Cat# 88-8007,
Ebioscience, Shanghai, China) was used to assess cell apoptosis as recommended by
the manufacturer. Cells treated with shVPS50 or shCtrl were
resuspended at a density of 1
Cells were harvested and then lysed on ice with 100
Data are shown as the mean
To examine the role of VPS50 in oncogenesis, VPS50 expression and mutation in various cancer types was investigated using published datasets. Data from the cBioPortal database (http://www.cbioportal.org/) showed high VPS50 expression in adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, CC, glioblastoma, lung adenocarcinoma and ovarian serous cystadenocarcinoma, but low expression in gastric adenocarcinoma (Fig. 1A). Various genetic alterations to VPS50 were also found in these cancer types, including gene amplification, point mutation and fusion, (Fig. 1B), with the former being the most frequent. The highest mutation frequency for VPS50 was found in gastric cancer, followed by lung cancer. Approximately 2% of all VPS50 mutations occurred in CC. The above results indicate that VPS50 may play a role in various cancer types. To investigate a potential role for VPS50 in CC, qPCR was carried out on two CC cell lines, Hela and SiHa. This confirmed that VPS50 was expressed at a high level in CC (Fig. 1C).

The expression and genetic variation of VPS50 in various cancer. (A) Expression of VPS50 in various cancers. Data were obtained from cBioPortal. (B) Mutation frequency of VSP50 in various tumors. Data were obtained from cBioPortal. (C) qPCR of VPS50 in two cervical cancer cell lines shows that VPS50 is high expressed in cervical cancer cell line.
To examine the function of VPS50 in CC, SiHa cells were infected with lentivirus that expressed shRNA directed against VPS50 (shVPS50), or with lentivirus that expressed a non-target control shRNA (shCtrl). This generated cells lines with stably repressed VPS50, and control cells with normally expressed VPS50, respectively. qRT-PCR assays showed the VPS50 mRNA level was significantly reduced by 50% in shVPS50-treated SiHa cells compared to shCtrl-treated SiHa cells (Fig. 2A). Moreover, VPS50 protein levels were also reduced in shVPS50 SiHa cells (Fig. 2B). These results indicated that lentivirus-mediated shRNA silencing efficiently inhibited the expression of endogenous VPS50 in SiHa cells at both the RNA and protein levels.

Validation of shRNA-mediated knockdown VPS50 in SiHa cells. (A)
qPCR analysis of VPS50 expression in VPS50 knockdown SiHa cells. Error bars
represent
Colony formation is an anchorage-independent growth assay considered to be the most stringent assay for detecting cell survival and proliferation in vivo. It was therefore used to determine the colony-forming ability of SiHa cells following VPS50 knockdown. Both the number and size of colonies were reduced in the VPS50 knockdown cells compared to the control cells (Figs. 3A,4B), indicating suppression of colony formation in SiHa cells following VPS50 knockdown. This may be due to the poor viability and decreased proliferation of SiHa cells following VPS50 knockdown.

Colony formation of VPS50 knockdown and control SiHa
cells. (A) Representative images of colony formation of VPS50 knockdown and
control SiHa cells. (B) Quantification of the total number of colonies in VPS50
knockdown and control SiHa cells. Error bars represent

Effect of VPS50 knockdown on the proliferation of SiHa
cells. (A) Representative images of SiHa cells infected with either
shCtrl or shVPS50 at different time points. (B,C)
Proliferation data are shown as cell numbers (B) and fold-changes of cell numbers
(C). Triple experiments were performed. Values were represented as mean
Reduced cell proliferation is a possible factor leading to decreased clonogenic
capacity. To investigate the role of VPS50 in proliferation, cells were seeded at
2
Increased apoptosis may account for the observed decrease in clone formation.
Hence, cell death was studied in VPS50 knockdown cells by
evaluating annexin V-APC apoptosis and Caspase 3/7 activity levels. Flow
cytometric analysis showed significantly more annexin V-APC positive cells in
the shVPS50-treated group compared to the control group (15

Effect of VPS50 knockdown on the survival of SiHa
cells. (A) Representative flow cytometric images of apoptosis of SiHa cells
infected with shCtrl or shVPS50. (B) Quantification of
Annexin-V positive cells. (C) Determination of Caspase 3/7 activity in SiHa cells
infected with shCtrl or shVPS50. Triple experiments were
performed. Values were represented as mean
A PathScan Stress and Apoptosis Signaling Antibody Array Kit was used to investigate possible molecular mechanisms by which VPS50 affects the survival of SiHa cells. VPS50 knockdown was associated with increased expression of cleaved PARP, cleaved Caspase-3, cleaved Caspase-7, IkBa, Survivin and a-Tubulin (Fig. 6). Furthermore, significantly increased phosphorylation levels for components of the stress and apoptosis pathway were detected in shVPS50-treated SiHa cells. These included p-ERK1/2, p-Bad, p-HSP27, p-p53, p-p38 MAPK, p-Chk1, p-Chk2 and p-eIF2 (Fig. 6). These results suggest that VPS50 downregulation induces apoptosis of SiHa cells by activating the Stress and Apoptosis pathway. Collectively, the increased apoptosis and decreased cell proliferation caused by VPS50 knockdown is likely to decrease the tumor forming ability of CC cells.

Knockdown of VPS50 inhibits Stress and Apoptosis
pathway in SiHa cells. Diagrams show quantification results of
PathScan® Stress and Apoptosis Signaling Antibody Array in VPS50
knockdown and control SiHa cells respectively. Error bars represent
A better understanding of the molecular mechanisms that underlie the progression of CC could lead to development of more effective therapies for this disease. Recently, many studies have implicated endocytosis in the development and progression of cancer. Further research into this process may therefore uncover potential targets for the treatment of CC [6,7]. Endosomal associated restorer protein (EARP) is a vital component of the endocytic pathway. Two of its subunits, VPS52 and VPS53, have already been identified as having important roles in tumor development [8,14-16]. However, the role of the most recently identified ERAP subunit, VPS50, remains unclear and only a few studies have so far been reported. VPS50 is expressed at high levels in T cells from atopic dermatitis and may be involved in the aetiology of this disease [14]. VPS50 is also expressed in neurons, where it may regulate vesicle acidification and therefore have a role in synaptic function. Functional mutations in VPS50 may also contribute to neurodevelopmental disorders [15,16]. Cancerous pancreatic ductal fluid contained increased levels of VPS50 compared to normal pancreatic ductal fluid, suggesting it may also play a role in this cancer type [17]. By analyzing public data, the present study found high levels of VPS50 expression in adrenocortical carcinoma, bladder urothelial carcinoma, invasive breast carcinoma, CC, glioblastoma, lung adenocarcinoma and ovarian serous cystadenocarcinoma, but low levels in gastric adenocarcinoma. It is worth noting that various genetic alterations to VPS50 have been reported in these tumor types, including gene amplification, point mutation and fusion. Amongst these, gene amplification is the most frequent alteration. Together, these findings suggest VPS50 may have an important role in tumorigenesis. Whether VPS50 expression or genetic alteration is associated with the clinical outcome of cancer patients requires further investigation.
The present results revealed a potential role for VPS50 in CC. Using lentivirus-mediated shRNA knockdown, it was demonstrated here that VPS50 is required for CC cell growth. Knockdown of VPS50 expression led to inhibition of CC cell proliferation, enhanced apoptosis of CC cells, and prevention of colony formation. In contrast to the apparent oncogenic effects of VPS50, two other members of the ERAP complex (VPS53 and VPS52) are thought to exert inhibitory effects on the growth of cancer cells. VPS52 induces apoptosis and acts as a suppressor of gastric cancer cells [9]. VPS53 has been shown to suppress tumor growth in human CC by regulating apoptosis pathways [10,11]. The possible reasons for these apparent functional differences between VPS proteins require further investigation, but may be due to the different cellular contexts in which they were studied. The different subunits could participate in the formation of alternate complexes depending on the cellular context.
The Path Scan Stress and Apoptosis Signaling Antibody Array was used here to
investigate the molecular mechanisms by which VPS50 can affect CC cell growth.
The results suggest that a large set of molecules involved in stress- and
apoptosis-related signaling were significantly altered by VPS50 knockdown,
including cleaved Caspase-3/7, Survivin, p-ERK1/2, p-Bad, p-p53, p-p38 MAPK and
p-eIF2. Cleaved PARP-1 and cleaved Caspase-3/7 are both well-known apoptotic
markers. Activation of p-p38 MAPK and p-p53 triggers programmed cell death [18-20]. In contrast, up-regulation of Survivin, p-Chk1/2, p-ERK and
p-eIF2
This is the first report of high VPS50 expression in CC and the first to suggest this endocytosis-related protein has an important role in CC pathogenesis. Downregulation of VPS50 expression in SiHa cells resulted in the inhibition of colony formation due to decreased cell proliferation and increased cell death. The mechanism by which this occurs is through activation of the Stress and Apoptosis pathway, thus preventing the survival of SiHa cells. These results provide strong evidence that VPS50 could serve as a potential therapeutic target for CC.
ZHY and TPP designed the research study. XYH and SJJ performed the research. XYH and WYG provided help and advice on the lentivirus infection experiments. SJJ and ZYM provided help and suggestions for apoptosis experiments. ZYM and WYG analyzed the data. ZHY and TPP wrote the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.
Not applicable.
We thank Genechem (Shanghai, China) for providing us with the lentiviral particles and technical assistance.
This work was supported by grants from the Shaoxing Bureau of Science and Technology Foundation of China (2018C30060) and Special Fund for people’s livelihood development project of Pudong New Area science and technology development (No. PKJ2017-Y34).
The authors declare no conflict of interest.